User:Saroj Pandey/Notebook/SNP PCR optimization/2014/10/08
Project name | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
PCR with spit sample• To eliminate the step of gDNA extraction, a PCR was designed by using spit (saliva) directly in place of template gDNA PCR 1 • Taster saliva was used in different volumes instead of template DNA Primers 1. Product size: 510bp [gaF + Gfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGC Observation: • Faint diffused bands were seen below 100bp for blank and also for the samples • No expected product (510bp) was seen in any of the reactions Conclusion: • Desired fragment of DNA could not be amplified with saliva sample
• Taster and non-taster saliva were collected, centrifuged (at 13000 g for 4 minutes) and the pellets were used as templates • Water was used as negative control template and respective gDNAs were used as positive control templates
1. Product size: 510bp [gaF + Gfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGC 2. Product size: 510bp [gaF + Cfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGG Observation: • Taster DNA was not amplified in all three reactions and the positive control gave a faint band at expected length • Non-taster DNA was amplified in all three reactions but the most prominent was with 3µl sample. However the positive control did not produce any band.
• PCR could be carried out using spit samples • In this experiment, the taster saliva used was clear while the non-taster saliva was thick. So there may be much less amount of cells in taster saliva. Increasing the amount of cells would lead to a successful amplification of the desired DNA fragment. • No product in non-taster positive control could be due to pipetting errors.
|