User:Saroj Pandey/Notebook/SNP PCR optimization/2014/10/08

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

PCR with spit sample

• To eliminate the step of gDNA extraction, a PCR was designed by using spit (saliva) directly in place of template gDNA

PCR 1

• Taster saliva was used in different volumes instead of template DNA

saliva PCR
saliva PCR
electrophoresis
electrophoresis

Primers

1. Product size: 510bp [gaF + Gfb(R)]

gaF: ATCCGTGATGCTGTGCTATG

Gfb(R): CAATCACTGTTGCTCAGTGC

Observation:

• Faint diffused bands were seen below 100bp for blank and also for the samples

• No expected product (510bp) was seen in any of the reactions

Conclusion:

• Desired fragment of DNA could not be amplified with saliva sample


PCR 2

• Taster and non-taster saliva were collected, centrifuged (at 13000 g for 4 minutes) and the pellets were used as templates

• Water was used as negative control template and respective gDNAs were used as positive control templates

saliva PCR
saliva PCR
electrophoresis
electrophoresis


Primers

1. Product size: 510bp [gaF + Gfb(R)]

gaF: ATCCGTGATGCTGTGCTATG

Gfb(R): CAATCACTGTTGCTCAGTGC

2. Product size: 510bp [gaF + Cfb(R)]

gaF: ATCCGTGATGCTGTGCTATG

Gfb(R): CAATCACTGTTGCTCAGTGG

Observation:

• Taster DNA was not amplified in all three reactions and the positive control gave a faint band at expected length

• Non-taster DNA was amplified in all three reactions but the most prominent was with 3µl sample. However the positive control did not produce any band.


Conclusion:

• PCR could be carried out using spit samples

• In this experiment, the taster saliva used was clear while the non-taster saliva was thick. So there may be much less amount of cells in taster saliva. Increasing the amount of cells would lead to a successful amplification of the desired DNA fragment.

• No product in non-taster positive control could be due to pipetting errors.



Personal tools