User:Tk/Notebook/MF-xfm/2008/04/08: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(Autocreate 2008/04/08 Entry for User:Tk/Notebook/MF-xfm) |
|||
Line 5: | Line 5: | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
== | ==Primers for recT gene== | ||
* | * gtttcttcgaattcgcggccgcttctagatgaataataaaattgaattaatattaaataattc,recT-F | ||
* gtttcttctactagtagcggccgctgcagttattaatcagaaaacatttcattaacagc,recT-R | |||
* gaaatgcaagaagcctatcaacatgaccaagcaataattattaataacagc,recT-mut-F | |||
* gctgttattaataattattgcttggtcatgttgataggcttcttgcatttc,recT-mut-R | |||
==Vector NTI file for recT mutated gene== | |||
* from S. citri protein CAK99381 | |||
* mutated to eliminate GATC site | |||
* biobricked, entered as part J70007 [[http://parts.mit.edu/registry/index.php/Part:BBa_J70007]] | |||
* [[media:recT-SC.gb]] | |||
==Transformations== | |||
* transform E. coli at 2.0 KV outgrow in 1 ml SOC rotated | |||
** plate out 100 μl at 1 hour/2.5 hour/3.5 hour | |||
* transform M. florum frozen cells | |||
** T1, perhaps sparked at 2.0 KV; outgrew anyway | |||
** T2, transformed at 2.0 KV without sparking | |||
** plated out 290 μl at 1 hour and 2 hour and 3 hour | |||
** Added 1 ul Tet to 300 ul culture at 2 hours for T1 and 1 hour for T2 | |||
** Plated out both tet and non-tet added cultures for T1 and T2 | |||
==Made electrocompetent cells== | |||
* 5 ml and 500 ul seed culture tubes (50 ml final) grown 18 hours at 30C | |||
* Spin down, resuspend in 45 ml EPB | |||
* again | |||
* again, in 20 ml | |||
* spin down, resuspend in remaining liquid, bring to 250 ul | |||
* add 35 ul 80% glycerol | |||
* Aliquot to 50 ul tubes | |||
* flash freeze in EtOH + dry ice | |||
<!-- ## Do not edit below this line unless you know what you are doing. ## --> | <!-- ## Do not edit below this line unless you know what you are doing. ## --> | ||
|} | |} |
Revision as of 21:44, 19 June 2008
MF-xfm | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Primers for recT gene
Vector NTI file for recT mutated gene
Transformations
Made electrocompetent cells
|