20.109(S15):16S PCR and paper discussion (Day3)

From OpenWetWare
Jump to navigationJump to search


20.109(S15): Laboratory Fundamentals of Biological Engineering

Home        People        Schedule Spring 2015        Assignments        Lab Basics        OWW Basics       
DNA Engineering        System Engineering        Biomaterials Engineering              

Introduction

Last week you prepared a DNA pool extracted from a bird cloacal swab, and today you will amplify 16S rDNA amplicons from that pool using PCR. PCR consists of repeated melting, annealing, and extension steps. During the annealing step of PCR, primers should largely bind to the target sequence, but some may bind to off-target sequences as well. Specificity of binding is controlled by both primer design and reaction conditions.

Error creating thumbnail: File missing
PCR schematic. Depicted are two complementary strands of DNA with a target fragment shown in green. Primers that can select the target sequence are shown as short arrows, with the dotted lines indicating the extension step of PCR. Note that in the first couple rounds of PCR, products longer than the desired target will be made (dotted lines keep extending). However, these early products themselves become templates that produce the correct product in abundance.

Gene amplification by PCR – whether of 16S rRNA or any other gene – comprises three main steps: 1) template DNA that contains a sequence of interest is melted, 2) primers anneal to specific locations on the now melted (i.e., single-stranded) DNA, and 3) the primers are extended by a polymerase to synthesize the desired product. Extension occurs at ~70 °C, melting at ~95°C, and annealing at a temperature ~5 °C below the primer melting temperature; thus, the repetition of these steps is called thermal cycling. After each cycle, the newly formed products themselves become templates, causing exponential amplification of the selected sequence. (Note that the early rounds of PCR will not produce the desired product – we will see why in today's pre-lab lecture.)

Based on the numerous applications of PCR, it may seem that the technique has been around forever. In fact it is just 30 years old! In 1984, Kary Mullis described this technique for amplifying DNA of known or unknown sequence, realizing immediately the significance of his insight.

Error creating thumbnail: File missing
Kary Mullis

"Dear Thor!," I exclaimed. I had solved the most annoying problems in DNA chemistry in a single lightening bolt. Abundance and distinction. With two oligonucleotides, DNA polymerase, and the four nucleosidetriphosphates I could make as much of a DNA sequence as I wanted and I could make it on a fragment of a specific size that I could distinguish easily. Somehow, I thought, it had to be an illusion. Otherwise it would change DNA chemistry forever. Otherwise it would make me famous. It was too easy. Someone else would have done it and I would surely have heard of it. We would be doing it all the time. What was I failing to see? "Jennifer, wake up. I've thought of something incredible." --Kary Mullis from his Nobel lecture; December 8, 1983

During the reaction itself, we can improve the reliability and accuracy of PCR by two key methods. The first is the use of a highly specific polymerase, one with either engineered or inherent hot start properties. Hot start means that the polymerase has reduced activity at low temperatures. Negligible activity at room temperature allows reaction assembly without chilling, while relatively low activity at typical annealing temperatures (50-55 °C) reduces binding of primers to non-target DNA. Eliminating non-specific binding is especially important when the target DNA may be present at a low concentration compared to the DNA in the sample as a whole, as in a complex mixture. Note that only engineered polymerases, such as those bound to accessory antibodies when at room temperature, are officially called "Hotstart." The polymerase you will use has much lower activity at typical annealing temperatures than does the laboratory workhorse Taq, but does so through an inherent rather than external mechanism.

The second performance enhancer we will use is bovine serum albumin (BSA), which is an especially important additive for amplifying DNA originating from a cloacal swab. Recall that these swabs include feces that are replete with inhibitors, including those that bind directly to DNA polymerases. As you saw if you clicked on the Kreader paper linked on Day 1, BSA itself binds many inhibitors of PCR, thus acting as a competitor. In other words, inhibitors should bind the BSA, rather than bind the polymerase and interfere with its function! BSA is hydrophobic and somewhat positively charged, making it a great non-specific binder of proteins that we will use time and again in 20.109.

Next time, you will visualize your entire reaction mixture in a gel to ensure a band of the correct size (~1400 bp) was amplified. Gel electrophoresis is a technique used to separate large molecules by size using an applied electrical field and appropriate sieving matrix. DNA fragments are typically separated in gels composed of agarose, a seaweed-derived polymer (see figure, below left). To prepare these gels, molten agarose is poured into a horizontal casting tray containing a comb. Once the agarose has solidified, the comb is removed, leaving wells into which the DNA sample can be loaded. The loaded DNA samples are then pulled through the matrix when a current is applied across it. Specifically, DNA molecules are negatively charged due to their phosphate backbones, and thus travel toward the positive charge at the far end of the gel (see figure, below right).

Error creating thumbnail: File missing
Scanning EM image of agarose polymer
Error creating thumbnail: File missing


Although all DNA molecules travel in the same direction during gel electrophoresis, they do so at different rates: larger molecules get entwined in the matrix and retarded, while smaller molecules wind through the matrix more quickly and thus travel further from the well. Ultimately, fragments of similar length accumulate into “bands” in the gel. Bands of DNA are usually visualized by adding the fluorescent dye ethidium bromide (or newer alternatives such as SYBR Safe) to agarose gels. This dye intercalates between the bases of DNA, allowing DNA fragments to be located in the gel under UV light and photographed. The intensity of the band reflects the concentration of molecules that size, although there are upper and lower limits to the sensitivity of dyes. Because of its interaction with DNA, ethidium bromide is a powerful mutagen and will interact with the DNA in your body just as it does with any DNA on a gel. You should always handle all gels and gel equipment with nitrile gloves.

One parameter that affects the way DNA travels through a gel is the pore size, which is in turn affected by both the weight percent of the gel and the type of agarose used. Because we are separating large DNA fragments (> 1 Kb) in the bacteria experiment, a low-to-medium percentage gel (namely 1.0%) is appropriate.

The 16S PCR will continue during the whole lab period. In the meantime, we will discuss a journal article, both to learn more about investigations of the microbiome and to become comfortable reading and discussing the primary scientific literature. You will also hear from our oral presentation instructor on how to give a good talk, and get immediate feedback on your informal presentation of one slide together with your partner. In 2-3 weeks, you will each present an article on your own.

Protocols

Part 1: Prepare PCR to amplify bacterial 16S sequences

  1. Begin by carefully labeling three PCR tubes (one 'no template control tube' and two reactions with your purified DNA from M1D1) with the date, sample name, and a unique symbol and/or color for quick identification. Filling in the cap tab with your team color will usually suffice.
  2. Pre-chill the tubes on a cold block.
  3. You and your partner can now prepare and share a so-called "master mix," which contains every PCR ingredient except the template and/or primers and/or polymerase. Here, you will omit only the template since we are all using the same primers. The polymerase should be added last. Prepare enough for the number of reactions you need to run, plus an additional 10%. In addition to the two DNA-containing reactions, you should prepare a no-template control that contains pure water without any plasmid. Feel free to use the table below for your calculations.
    • When the master mix is not in use, keep it on ice.
    • What do you expect to see in the no-template control case?
  4. Combine 45 μL of master mix and 5 μL of template in a PCR tube. When everyone's reactions are ready, they will undergo the cycling conditions listed below.
    • Add the master mix first, because the template alone may freeze. Then add the template and gently mix the reaction with a larger pipet.
Reagent Amount for 1 reaction (μL) Amount for 3 reactions + 10%
PfuUltra buffer (10X stock) 5
Primer mix 1
dNTPs 1
1% BSA (100X stock) 0.5
Water 36.5
PfuUltra polymerase 1
DNA template 5 N/A
Segment Cycles Temperature (° C) Time
1 1 95 5 min
2-4 35 95 1 min
51 1 min
72 2 min
5 1 72 10 min
6 1 4 indefinite

Parts 2 + 3: Journal article discussion and WRAP session

Scientific papers are dense and often time-consuming to read and understand, but with practice, you will find strategies that improve your comprehension efficiency. Here's one tip to get you started: when reading newly reported results, be sure to refer to the associated figures frequently, because visual information is often easier to take in than purely verbal descriptions.

Technical Background

Several terms and approaches in the Koenig et al. paper may be unfamiliar to you. Here we will provide some background on selected topics. You should feel free to search for information about additional topics – even Wikipedia can be a good start! At the same time, don't feel the need to understand every detail presented in the paper.

Named for the company that developed the technique, 454-pyrosequencing is one example of a next generation sequencing method. Such methods were designed to enable efficient and accurate identification of many, many sequences at once. You can learn about this particular approach at the company website.

Metagenomics refers to the investigation of microbiome diversity via all genes occuring in an environmental sample – as opposed to via one gene (usually 16S rRNA) alone. You can learn more in the linked review papers here and here if you wish.

Prof. Runstadler will address 16S rRNA approaches in lecture, and you can also refer to the Day 1 and Day 2 wiki introductions.

You can learn about UniFrac software at the linked paper or the direct site. It was used by the authors for some of their analyses.

Discussion Topics

Writing

As you read the paper by Koenig et al., consider not only its scientific content, but also the authors' writing style (perhaps not all on one read!). Sketch out answers to the questions below, right on the paper if you wish. Your answers will not be collected, but you may be called on in discussion to share your ideas.

  • What functional elements does the abstract contain? As a whole, did the abstract make you want to read the paper?
  • Now consider the Introduction section.
    • What is the topic and/or function of each paragraph?
    • How closely does this introduction conform to the suggested three-section structure described in the class scientific writing guidelines? Is there too much, or too little, information or emphasis on any particular topic?
    • What purpose(s) do the citations serve?
  • Now consider the Results section.
    • What purpose do the sub-section titles serve? Which ones do so most effectively?
    • Can you find one or more examples of paragraphs with effective introductory and concluding sentences, according to the description here?
    • How about examples with ineffective opening and closing sentences? How might you improve these?
    • Are there any parts in the Results that you think belong in the Discussion instead, according to the descriptions here and here ?
  • Finally, consider the Discussion section.
    • What is the topic and/or function of each paragraph?
    • Is there too much or too little information or emphasis on any particular topic?
    • Have the authors framed their writing to suggest future studies?
    • What purpose(s) do the citations serve?
Content

You were previously assigned one of the topics below to present to and discuss with the rest of the class. We'll now break to listen to Atissa's talk about giving talks, then give you some time to revise the slide that you prepared, and finally go through the slides and topics one by one. Per slide, we'll first discuss scientific content, and then give you feedback about your slide design and presentation -- briefly and informally.

  • Figure 1 – assigned to T/R Purple Team and W/F Pink Team
    • How is phylogenetic diversity (PD) defined? What general trend was observed? How do the authors interpret various exceptions to the trend?
  • Figure 2 – assigned to T/R Shannon and W/F White Team
    • Skim the linked paper about UniFrac software, and refer to it to explain the basic idea of principal coordinates analysis to your peers. What additional information is learned in Fig 2 as compared to Fig 1?
  • Figure 3 – assigned to T/R Yellow Team and W/F Yellow Team
    • What changes in bacterial population do the authors observe over time and to what life events do they attribute them? Which timespan population would you expect to vary the most among different infants, and which would you expect to be most similar across different infants?
  • Figure 4 – assigned to T/R Blue Team and W/F Blue Team
    • Briefly, define what C-score and checkerboard analysis measure. How did the authors decide whether these values were higher, lower, or the same as might be expected? What primary conclusion do they draw?
  • Figures S1 + S2 – assigned to T/R Orange Team and W/F Orange Team
    • What general trends in SCFA concentrations and bacterial load did the authors find, with respect to time? How did the authors approach error measurement, and how reliable does each dataset appear to you?
  • Figure 5 (focus on 5C) – assigned to T/R Green Team and W/F Green Team
    • Make sure you understand (and can explain) how to read a correlation matrix before you begin. How do the authors interpret the correlations they find when looking at bacterial diversity and metabolite concentrations together?
    • If you have time to look at 5A and 5B... do the figures appear to accurately reflect the text?
  • Figure 6A + S4 – assigned to T/R Shannon and W/F Red Team
    • What is the difference between the approach the authors take in 6A and S4? How do they explain the differences in their findings by said methods?
  • Figure 6B + Table S5 – assigned to T/R class will discuss and W/F Purple Team
    • Describe a few trends in gene abundance that the authors found. How easily can you discern these findings from the figure and table? How might you redesign the figure and/or table for easier use by the reader?

Homework

Due on M1D4

  1. You will write up the work you do in the bird gut microbiota experiment as an abstract and data summary. To help you pace your work, as well as give you feedback early on, you will be required to draft small portions of the report as homework assignments. For next time, you should prepare the overview schematic of your experimental approach.
    • Begin by reading the format guidelines and the beginning of the suggested figures section through the experimental overview section.
    • You may prepare something similar to the assay depiction from the lecture notes, but should NOT copy and insert it directly. Your goal should be to make a figure tailored specifically to this assignment and audience. What elements might be cut or added? How can you modify the figure to best highlight key takeaways?
    • Be sure to include a title and caption for your schematic!
  2. Every scientific publication includes a Methods section that contains information about how the experiments reported in the paper were conducted. We do not require you to prepare a formal Methods section for Module 1, but you will have to write one for your research paper in Module 2. Many people find the Methods section to be kind of tricky to write -- it must be shorter than a protocol, but contain all of the necessary information for your readers to understand (and repeat!!) your experiments. To give you some practice, and a low-pressure, low-grade-weight introduction to Methods writing you'll complete a couple homeworks reporting the methods for Mod1. For this assignment you should write an early draft of the methods you completed thus far (DNA extraction and PCR). Be sure to read the Materials and Methods guidelines before you begin; doing so may save you some effort. Keep the following in mind:
    • The clarity of the methods section is driven in part by the effectiveness of its sub-section titles and topic sentences.
    • A useful methods section also requires good choices about what information to include: what is essential to reader understanding and what is merely a distraction?
  3. Day 4 of this module is poised to run long, so you should read Parts 2 and 3 of the protocol in full and perhaps prepare some of your lab notebook in advance. In addition, to save time later you should prepare an automated worksheet (e.g., in Excel) that will calculate the amount of PCR product you will use in your cloning reaction. A copy of your worksheet must be handed in using the mock numbers provided below.
    • First, enter the known elements: the vector size is 3500 bp and the concentration is 25 ng/μL.
    • Another known element, but one that you must calculate yourself based on Day 3, is the size of the PCR product, hereafter just called the insert. Scroll down to the reagent list and note that the primers are named according to the base-pair sites that they span.
    • Next, prepare spaces for variable elements: desired molar ratio; concentration of insert; volume of both vector and insert; mass of both vector and insert .
    • For the desired molar ratio, begin with 10:1 insert:backbone. For volume of vector, begin with 1 μL, and calculate the mass.
      • Note: The range of use for the vector is 5-25 ng per reaction.
      • Note: The molar ratio range is 2-10x, with higher generally being better and at least 3-4x being known to work in our system.
    • You will determine the insert concentration by the appearance of the gel that you run on Day 4. Familiarize yourself with the band sizes and associated masses of the NEB marker that we will use.
    • What if your insert looks similar in brightness to the 3 Kbp band? What mass of insert is in that lane?
      • If you are unsure, assume 100 ng.
    • Peeking ahead at the Day 4 protocol, determine what volume of DNA was in the lane, taking into account dilution by the loading dye.
      • If you are unsure, use 15 μL.
    • From the mass and volume of insert, calculate its mass concentration.
    • Based on the amount of vector and molar ratio listed above, what volume of insert do you want to use in the ligation reaction?
      • Perhaps the most efficient route to this calculation is to begin with the ng of vector to be used, and in about 5 steps multiply ratios and cancel units until you end up with a volume of insert.
      • Note that a typical double-stranded DNA base-pair is about 660 g/mol. If you approach this calculation correctly, this number should overall cancel out in your equation.
    • Make sure that your final answer passes a sanity check. How does mass of a piece of DNA versus moles of a piece of DNA scale with size?
    • Finally, note that in your reactions, you cannot use more than 5 μL of insert. If you don't change the volume of vector that you use, to approximately what value will you need to lower the molar ratio? You may round to the nearest whole number.

Reagent list

  • PfuUltra polymerase and buffer from Agilent
  • dNTPs from Promega, original stock at 10 mM of each base
  • Primers
    • intermediate stock concentration is 5 μM for each primer (10 μM total), diluted from individual 100 μM long-term stocks
    • F8-27 sequence: 5' AGAGTTTGATCCTGGCTCAG
    • R1392-1407 sequence: 5' ACGGGCGGTGTGTACA

Next Day: DNA cloning

Previous Day: Diagnostic primer design