BME100 f2014:Group5 L5

From OpenWetWare

Jump to: navigation, search
BME 100 Fall 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png


Contents

OUR TEAM

Name: Sahar Mohamed
Name: Sahar Mohamed
Name: Megan Danforth
Name: Megan Danforth
Name: Keaton Sorenson
Name: Keaton Sorenson
Name: Zahra Khuraidah
Name: Zahra Khuraidah
Name: Jad Jazzar
Name: Jad Jazzar
Name: Christopher Rojas
Name: Christopher Rojas


LAB 5 WRITE-UP

Procedure

Smart Phone Camera Settings

  • Type of Smartphone: Galaxy S5
    • Flash: off
    • ISO setting: 800
    • White Balance: Auto
    • Exposure: N/A
    • Saturation: N/A
    • Contrast: N/A


Calibration
Description of image

  • Distance between the smart phone cradle and drop = 4 cm


Solutions Used for Calibration

Concentration of 2X Calf Thymus DNA solution (micrograms/mL) Volume of the 2X DNA solution (μL) Volume of the SYBR GREEN I Dye Solution (μL) Final DNA concentration in SYBR Green I solution (μg/mL)
5 80 80 2.5
2 80 80 1
1 80 80 0.5
0.5 80 80 0.25
0.25 80 80 0.125
0 80 80 0



Placing Samples onto the Fluorimeter

  1. Set up the fluorimeter so that the phone taking pictures is around 4 cm away and on the same height as the laser.
  2. Insert a new slide rough side up into the fluorimeter.
  3. Adjust the slide so that the small circles are bisected by the laser.
  4. Choose one of the circles intersected by the laser and add 80 μL of SYBR Green I solution.
  5. Choose another circle intersected by the laser that is next to the circle with the SYBR Green I solution just added and add 80 μL of Calibration or Sample.
  6. The drops should meet in between the circles and stay in the beam of the laser.
  7. Take the picture of the sample and make sure the photo is focused.



Data Analysis

Representative Images of Negative and Positive Samples

Description of image

Positive

Description of image

Negative


Image J Values for All Calibrator Samples


Image J Values '
Concentration:TrialAreaMeanRawIntDenDropRawIntDenBackgroundDrop - Background
0:01302966.622200607370484-169877
0:02331765.065168041362721-194680
0:034275216.918723296222323500973
0.25:1452487.407335160225188109972
0.25:2522647.761406514235836170678
0.25:3530568.307440762237667203095
0.5:15305626.25613930223031241089898
0.5:25544030.55916941693514141342755
0.5:35226422.9411198970293019905951
1:015146441.37321292303833031745927
1:024948445.43422482744279591820315
1:035384446.97525293292977382231591
2:015116077.94639877085409983446710
2:025495677.77842743513663313908020
2:035344080.50543021966654873636709
5:0158532118.40669305274732926457235
5:0259608110.69265981235114186086705
5:0356840115.99365930214079576185064
123AverageStandard DeviationX-Axis Int
0-169877-19468050097345472394670.3281892370
0.25109972170678203095161248.33333333347272.21427364420.25
0.5108989813427559059511112868219306.0630238020.5
11745927182031522315911932611261582.0596600621
23446710390802036367093663813231846.2834228752
56457235608670561850646243001.33333333191939.2382248445


Calibration curve
Description of image

PCR Results Summary

  • Our positive control PCR result was 1.41 μg/mL
  • Our negative control PCR result was 0.3 μg/mL

Observed results

  • Patient 54942: Negative
  • Patient 69456: Positive

Conclusions

  • Patient 54942 : Not infected with disease
  • Patient 69456 : Infected with disease




SNP Information & Primer Design

Background: About the Disease SNP

Polymorphism is when there is genetic variation within a population. This can occur through natural selection. Nucleotides are the basic structural units of DNA, when the bases are switched this causes genetic variations or mutations. The SNP rs16991654 is only found in humans (Homo sapiens) and occurs on the 21st chromosome. The clinical significance of this SNP is that it is a pathogenic allele. The gene affected by this SNP is KCNE2, which stands for potassium voltage-gated channel, Isk-related family, member 2. KCNE2 gene has a variety of functions these include: regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. An allele is two or more alternative forms of a gene that are created through mutations and are located on the same place on a chromosome. When this gene contains the disease-associated allele sequence is CTC.

Primer Design and Testing

The primers we created worked as expected. The primers were created by isolating where the disease SNP is located in the genome. With that location, 20 base pairs were matched on either side of the disease coding sequence so that primers could be created at that specific location. In layman's terms, the primers hold the coordinates to the corresponding location on the human genome. The Non-Disease Primers (Forward and Reverse) worked and created the 220bp long sequence where the disease would be. The Disease Primers (Forward and Reverse) contained no matches. This is because the primers are trying to match onto DNA that does not contain the disease. The forward primer cannot attach because of the difference in base pairs between the forward non-disease primer (CATGGTGATGATTGGAATGT) and the forward disease primer (CATGGTGATGATTGGAATGC). The only difference is the T changes to a C in the disease primer. The reverse primers for disease and non-disease are the same. The following pictures are from the test to tell if the primers will work.

Description of image

Personal tools