BME100 f2016:Group13 W8AM L4

BME 100 Fall 2016	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Christian Sulit Role(s) Name: Scott Colebeck Role(s) Name: Valerie Cortez Role(s) Name: Samson Nguyen Role(s) Name: Mingdi Lu Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/) DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction List Tube Label PCR Reaction Sample Patient ID G13 + Positive control PC G13 - Negative control NC G13 1-1 Patient 1, replicate 1 11385 G13 1-2 Patient 1, replicate 2 11385 G13 1-3 Patient 1, replicate 3 11385 G13 2-1 Patient 2, replicate 1 54376 G13 2-2 Patient 2, replicate 2 54376 G13 2-3 Patient 2, replicate 3 54376 DNA Set-up Procedure Test tube preparation Acquire 8 empty PCR tubes tubes and label them as follows (Note: Label the SIDES, not the tops of the tubes) PC NC P1R1 P1R2 P1R3 P2R1 P2R2 P2R3 Place all 8 empty PCR tubes in a test tube rack Acquire the provided 8 test tubes of DNA/Primer Mix (50 μL each) and 8 test tubes of PCR Reaction Mix (50 μL each) and place them in another test tube rack Preparing Mixtures Take the empty Positive Control tube and pipette 50 μL of the PCR Reaction Mix into the test tube. Discard disposable tip into collection cup after use to avoid cross-contamination. Using a fresh pipette tip, transfer 50 μL of the corresponding DNA/Primer Mix into the same test tube. This should raise the total volume of the test tube to 100 μL. Repeat step 2 for each of the remaining empty PCR tubes, using the appropriate DNA/Primer mix for each corresponding tube. When finished, each test tube should contain a 100 μL mixture of DNA/Primer Mix and PCR Mix. Make sure all test tube lids are closed tightly, and place the finalized PCR tubes into the thermal cycler OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology Function of PRC and the components involved in a PRC A polymerase chain reaction (PCR) is the rapid method by which specific sections of DNA containing genes of interest can be made and collected from a single complete piece of DNA. A PCR requires four components: Template DNA, Primers, taq Polymerase, and Deoxyribonucleotides (dNTP’s). Template DNA​ is just as isn’t name indicates. It is the original complete piece of DNA that is being copied in order to create the smaller sections of DNA for study. The primers are small sections of DNA that attach to the template DNA and work as an indicator to the taq Polymerase what section of the DNA needs to be replicated. The primer is designed specifically for the section of DNA containing the gene that is being studied. Taq Polymerase​ is what attaches complementary nucleotides to the template DNA to create a complete paired section of DNA. dNTP’s are the ‘loose’ nucleotides of building blocks of DNA that are bonded to the exposed nucleotides of the template DNA. Thermal Cycling PCR does not simply occur once the four components are placed together in solution, several cycles of differents heat at different times are required to perform a PCR. The initial step is begins at 95°C for 3 minutes. During this time and at this temperature the template DNA strands will straighten out looking like a latter opposed to DNA’s standard shape of a double-helix. At the same temperature of 95°C for 30 seconds after the DNA is straightened it is denatured, meaning that DNA is nucleotide bonds are broken and the DNA is separated. The temperature is then reduced to 57°C for 30 seconds. Over this time the the cooling allows the engineered primers to anneal​ or attach to the appropriate binding site on the template DNA. Once the primers have bonded to the template DNA, the temperature is increased to 72°C for 30 seconds, at which time the taq polymerase will move forward along the template DNA bonding the appropriate nucleotides the the exposed nucleotides of the template strand. These same step are repeated over several cycles for several hour to obtain an adequate amount of DNA segments for studying. Once the final PCR occurs the DNA is held at 72°C for 3 minutes to ensure that the DNA strands will remain fully extended. After all this is completed the DNA held at 4°C while it is being tested and studied. Base pairing-DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. The A base stands for Adenine which bonds to the T base, Thymine. Cytosine is the name of the C base and it will bond with Guanine, which is the G base. During PCR there are two step in which base-pairing will occur. The first step is when the temperature is reduced to 57°C for 30 seconds. This is the time when the primer will anneal to the template DNA. The second is when the taq polymerase binds to the primer and extends forward bonding the ‘loose’ nucleotides to the exposed nucleotides. This bonding occurs when the temperature is increased to 72°C for 30 seconds. SNP Information & Primer Design Background: About the Disease SNP To better understand more about this disease SNP there are some general words that need to be understood: The first is nucleotides, which are the building blocks of nucleic acids, such as DNA. In DNA there are four nucleotide bases: adenine(A), guanine (G), cytosine (C), and thymine (T).These bases each pair with a specific base on the adjacent strand of DNA. A will bond with T and C will bond with G. The second is polymorphism, which is a variation of a single nucleotide of one member of a species from the standard DNA sequence found commonly in the rest of the species. This particular Disease SNP is found in humans, latin name Homo Sapiens. The variation is located on chromosome 4. The Clinical significance lists this SNP a pathogenic, which often times means that it causes a disease. Research on this particular SNP has linked it to Cardiac Arrhythmia Syndrome. Primer Design and Testing It is important to understand the DNA sequence of the SNP to design a primer to isolate it. An allele is the alternative forms of a genes formed from a mutation that is located in the same position in a chromosome. The disease-associated allele contains ATC opposed to the CTC of the non-disease-associated allele. This SNP is located at 113367751. ​ Primer Design Non-disease forward primer (20 nt): 5’- GGACAGCTCAGCAACAGCAC The numerical position exactly 200 bases to the right of the disease SNP is 113367951. Non-disease reverse primer (20 nt): 5’- TAAAAAGTATTTAAAAACTAG Disease forward primer (20 nt): 5’- GGACAGCTCAGCAACAGCAA Disease reverse primer (20 nt): 5’- TAAAAAGTATTTAAAAACTAG The Non-Disease Primer Test Results The Disease Primer Test Results