BME100 f2018:Group10 T0800 L4

BME 100 Fall 2018	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Calvin Huang Role: Researcher Name: Victoria Dong Role: Researcher Name: Jonathan Scirone Role: Researcher Name: Atlee Thompson Role: Researcher Name: Emily Volz Role: Researcher LAB 4 WRITE-UP Protocol Materials a. Lab Coat and Disposable Gloves b. PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP's c. DNA/ primer mix, 8 tubes, 50 μL each (note: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer.) d. A strip of empty PCR tubes e. Disposable pipette tips f. Cup for discarded tips g. Micropipettor h. OpenPCR machine PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G10 + Positive control none G10 - Negative control none G10 1-1 Patient 1, replicate 1 61026 G10 1-2 Patient 1, replicate 2 61026 G10 1-3 Patient 1, replicate 3 61026 G10 2-1 Patient 2, replicate 1 86834 G10 2-2 Patient 2, replicate 2 86834 G10 2-3 Patient 2, replicate 3 86834 DNA Sample Set-up Procedure Move the extracted DNA sample into the specialized PCR tube using a pipette Throw away the disposable Pipette tip Add primer 1 to the PCR tube using a pipette Throw away the disposable Pipette tip Add primer 2 to PCR tube using a pipette Throw away the disposable Pipette tip Add nucleotides to the PCR tube using a pipette Throw away the disposable Pipette tip Add DNA polymerase to the PCR tube Throw away the disposable pipette tip Place the PCR tube in the DNA thermal cycler Turn on the DNA thermal cycler and wait for the cycles to complete OpenPCR program Heated Lid: 100°C Initial Step: 95°C for 2 minutes Number of Cycles: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds Final Step: 72°C for 2 minutes Final Hold: 4°C Research and Development PCR - The Underlying Technology PCR uses thermal cycling to separate and copy certain sections of a double stranded DNA molecule. The process of PCR involves four main components: template DNA, primers, Taq polymerase, and Deoxyribonucleotides. Template DNA is the non-coding strand of the helix that is copied during transcription. Primers are short pieces of DNA that are made in a labratory. Primers are used in PCR because of their ability to have any desired sequence of nucleotides. Taq polymerase is a durable DNA polymerase that is necessary to seperate two complementary strands of DNA in the test tubes. Because of it's ability to withstand the high heats of the thermal cycler and to operate at cold temperatures, Taq polymerase is especially effective in PCR. Finally, Deoxyribonucleotides are the building blocks for DNA molecules that are used by the DNA polymerase to build the copies of the DNA. There are three main phases of thermal cycling. The first step is denaturing. During denaturing, the cycler heats up to 95°C, seperating the Template DNA protected by Taq polymerase from the coding strand and splitting the double helix. By the end of denaturing, the hydrogen bonds between the coding strand and template are completely broken. Next are the phases at which base pairing occurs. During both of the following steps, deoxyribonucleotides are added to the single-stranded template DNA based on the base-pair needed by the template, with Adenine (A) pairing with Thymine (T) and Guanine (G) pairing with Cytosine (C).The first base-pairing phase is annealing. Annealing occurs when the thermal cycler cools down to 57°C, allowing the primer molecules to pair with the single stranded template DNA. Finally, the last phase of PCR is extension. In the extension step, the thermal cycler heats up to 72°C, activating the Taq polymerase. Once activated, Taq polymerase binds to the primers and begins to add the deoxyribonucleotides. Following extension, the process is repeated until the solution is almost entirely made up of the target DNA and is held at 4°C. SNP Information & Primer Design Background: About the Disease SNP An allele is one of two or more alternative forms of a gene that arises by mutation and are found in the same place on a chromosome. A single-nucleotide polymorphisms (SNPs) are variations of a single nucleotide that occurs at a specific position in the genome. The variation rs721710 is found in homo sapiens and is located on the chromosome 12:40315266. The clinical significance of this SNP is uncertain but it is linked to Parkinson's disease. The name of the gene is LRRK2 which stands for leucine rich repeat kinase 2. LRRK2 is responsible for ATP binding, GTP binding, and GTP-dependent protein kinase activity. The disease-associated allele contains the codon GAG. Primer Design and Testing The numerical position of the SNP is 40315266. The non-disease forward primer is 5' TTAAGTGACTTGTACTTTGT 3' and the non-disease reverse primer is 5' TGAAGCTCTTCAAGTAGTCT 3'. The disease forward primer is 5' TTAAGTGACTTGTACTTTGA 3' and the disease reverse primer is 3'.