BME100 f2018:Group11 T0800 L4

BME 100 Fall 2018	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Katelyn Meehan Role: Researcher - Part A Name: Michail Maltsev Role: Researcher - Part B Name: Soledad Carrillo Role: Researcher - Part B Name: Abigail Ouellette Role: Researcher - Part B Name: Antara Sira Role: Researcher - Part A LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 5 µL each: Mix contains: Taq DNA Polymerase, MgCl2, and dNTP's. DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips:only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross‐contaminated. Cup for discarded tips Micropipette OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G# + Positive control none G# - Negative control none G# 1-1 Patient 1, replicate 1 70758 G# 1-2 Patient 1, replicate 2 70758 G# 1-3 Patient 1, replicate 3 70758 G# 2-1 Patient 2, replicate 1 23525 G# 2-2 Patient 2, replicate 2 23525 G# 2-3 Patient 2, replicate 3 23525 DNA Sample Set-up Procedure Obtain all materials as listed above Cut linked PCR tubes in half - this should result in two strips of PCR tubes with four linked tubes per strip Label the sides of each tube with tube labels - NOT THE TOP, then place the tubes in tube rack Using the micropipette transfer 50 µL of PCR reaction mix into the empty positive control tube. With a new tip transfer the positive control DNA and primer mixture. This should result in a total of 100 µL in the tube. Repeat step 4 and 5 for the negative control tube, patient 1 replicates 1, 2, and 3, and patient 2 replicates 1, 2, and 3. Be sure to use the respective DNA and primer mixtures. Place all the tubes in the heating block slots of the assigned PCR machine. Once all 16 slots are filled, run the machine. OpenPCR program Heated Lid: 100℃ Initial Step: 95℃ for 2 minutes Number of Cycles: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds Final Step: 72°C for 2 minutes Final Hold: 4°C Research and Development PCR - The Underlying Technology Polymerase Chain Reaction A Polymerase Chain Reaction involves several components. The template DNA is the small amount of DNA needed to start the PCR. Primers mark the DNA sequence being targeted for replication. Taq Polymerase enzymes bind to the primers and begin the process of replication by extending the new DNA strand through the process of base pairing. Deoxyribonucleotides (dNTP’s) are free-floating DNA monomers that form the new DNA strands by way of the taq polymerase and complementary base pairing. Step-By-Step Breakdown During the initial step, which is at 95°C for 2 minutes, the initial DNA strand in the PCR tube exists as a double stranded nucleic acid; as the temperature rises it gets agitated. Over the next 30 seconds at 95°C, the two strands of DNA separate, or denature, allowing each strand to be used as a template for the replication step. The temperature is then reduced to 57°C for 30 seconds, during which time the DNA sequences known as primers bind, or anneal, to complementary sequences on the template DNA strands. The temperature is then raised to 72°C for 30 seconds, allowing the taq polymerase enzymes to bind to the primers and begin the process of base pairing. A the temperature remains at 72°C for an additional 2 minutes, the taq polymerase enzymes add nucleotides to the primers through complementary base pairing, building the new strand of DNA. Finally, the temperature is reduced to 4°C and held. This separates the taq polymerase enzymes from the DNA strands, stopping the replication process. At this temperature the solution stabilizes, so that nothing else occurs. Composition of DNA A DNA nucleotide comprises of a deoxyribose sugar, a phosphate group, and a nitrogenous base. The nitrogenous base can be one of four: A,T,C,G. Each of them have specific binding capabilities. Adenine (A) binds to the T base. Thymine (T) binds to the A base. Cytosine (C) binds to the G base. Guanine (G) binds to the C base. Base Pairing During PCR Base pairing occurs during the steps at 72°C. During the initial step at 72°C, the taq polymerase enzyme binds to the primer. The taq polymerase builds the new strand by attaching free-floating deoxyribonucleotides to the primer sequence through the process of complementary base pairing. SNP Information & Primer Design Background: About the Disease SNP SNP stands for single nucleotide polymorphism. Nucleotides are structural components of DNA and RNA which include adenine, guanine and cytosine. They also have a molecule of sugar and phosphoric acid. Polymorphism is discontinuous genetic variation which results in different forms of individuals within a species. SNP is where one nucleotide is different, causing a different form of an individual within a species. The Variation of the SNP, rs721710, is found in Homo sapiens, and the chromosome that the variation is located on is 12:40315266. While the clinical significance of the SNP is uncertain, it is linked to Parkinson’s Disease. The mutations in the Leucine-rich rich kinase 2 gene is has been the most common cause of Parkinson’s Disease. The LRRK2 focuses on ATP and GTP binding and with GTP dependent protein kinase activity. An allele is an alternative form of a gene that is caused by a mutation, and they are on the same place in a chromosome. The non-disease allele has the codon GTG, and the disease associated allele has the codon GAG. the non-disease forward primer is 5’ - TTAAGTGACTTGTACTTTGT - 3’.the numerical position that is exactly 200 bases to the right is 40315466. The non-disease reverse primer that goes from this position is 5’ - TGAAGCTCTTCAAGTAGTCT - 3’. The disease forward primer switches the codon to GAG, making the forward primer 5’ - TTAAGTGACTTGTACTTTGA -3’ and the reverse primer 5’ - TGAAGCTCTTCAAGTAGTCT - 3’. Primer Design and Testing The non disease forward primer is 5’ - TTAAGTGACTTGTACTTTGT - 3’ and the reverse primer is 5’ - TGAAGCTCTTCAAGTAGTCT - 3’. The non-disease forward and reverse primers from the reference SNP rs721710 are validated when they were entered into the online non-disease human genome sequence, showing a 220bp in figure 2. This had the non-disease allele containing the GTG codon. The disease allele has a change in the T, making the codon GAG. The forward disease primer is 5’ - TTAAGTGACTTGTACTTTGA - 3’ and the reverse primer is 5’ - TGAAGCTCTTCAAGTAGTCT - 3’. When the disease forward and reverse primers are entered, there were no matches, shown in Figure 1. The disease primers should not match with the non-disease human genome sequence, so this would be valid as well. Figure 1 - Disease Human Genome Sequence Figure 2 - Non-disease Human Genome Sequence