PCR reaction mix, 8 tubes, 50 microliters each: Mix contains Taq DNA polymerase, Magnesium Chloride, and dNTP's
DNA/ primer mix, 8 tubes, 50 microliters each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse
A strip of empty PCR tubes
Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G15 +
Positive control
none
G15 -
Negative control
none
G15 1-1
Patient 1, replicate 1
22111
G15 1-2
Patient 1, replicate 2
22111
G15 1-3
Patient 1, replicate 3
22111
G15 2-1
Patient 2, replicate 1
14162
G15 2-2
Patient 2, replicate 2
14162
G15 2-3
Patient 2, replicate 3
14162
DNA Sample Set-up Procedure
Create 8 PCR tubes by splitting every 4 strips in half
Use Tube Labels to label the sides of the tubes and place them in the rack.
Pipette 50μL of the PCR reaction mix onto the empty positive control tube.
Discard the pipette tip in the collection cup to avoid cross-contamination
Add 50μL of Primer mix(positive control DNA) into the same positive control tube which will change the volume into 100μL.
Repeat steps 4 and 5 for negative control using primer mix for the corresponding tubes. At the end, all tubes should consist of 100μL.
Close the tube lids tightly
Take the tubes to the PCR machine and place into the heating block.
Start the machine after all 16 slots are filled. Ask TA if you are unsure to start the PCR machine.
OpenPCR program
Heated Lid: 100 degrees Celsius
Initial Step: 95 degrees Celsius for two minutes
Number of Cycles: 25
Denature at 95 degrees Celsius for 30 seconds, Anneal at 7
degrees Celsius for 30 seconds, and extend at 72 degrees
Celsius for 30 seconds
Final Step: 72 degrees Celsius for 2 minutes
Final Hold: 4 degrees Celsius
Research and Development
PCR - The Underlying Technology
Components of a PCR Reaction
Template strand allows the Polymerase to attach complementary strand based on the template strand during DNA replication. Primers are fragments of DNA created in the lab which attach to the DNA segment of interest. DNA is copied by Taq Polymerase combining nucleotides with the DNA Template. Deoxyribonucleotides are a single unit of DNA which consists of a nitrogenous base, deoxyribose sugar, and one phosphate group.
Thermal Cycle
The initial step of thermal cycling is to keep the sample at a temperature of 95°C for 2 minutes. This allows the DNA to enter the denaturing stage. Once the denaturing stage begins, the DNA must be allowed to sit at 95°C for 30 seconds: The two strands of DNA will then separate into two separate strands. The second step will consist of the annealing stage. During this step, the sample must be kept at 57°C for 30 seconds so that the primers can connect to the template DNA via hydrogen bonding. The third step is the extend phase. This phase will take place at 72°C for 30 seconds. The polymerase is now able to make the new strand of DNA from the loose strands. It now connects to the primer and makes DNA bases. The final step of thermal cycling begins at 72°C for 2 minutes. Here, the polymerase connects to the primer and makes DNA bases. Once this is complete, the sample should be kept at 4°C; the temperature that the DNA is held at after the copying process is complete.
Base pairs that stick together
Adenine always pairs with Thymine.
Cytosine always pairs with Guanine.
Two steps of thermal cycling where base-pairing occurs
Annealing is when the polymer is cooled, allowing the primer DNA to bind to target DNA.
Extension is when heating allows nucleotides to bind to polymer base pairs.
SNP Information & Primer Design
Background: About the Disease SNP
This SNP is found in the species Homo sapiens. This variation is found in the 12:40315266 chromosome.
The numerical position of this specific SNP in the genome is 40315266.
The disease-associated allele contains the codon GAG, which is a mutation from the normal codon GTG.
This SNP is important because the condition linked to this SNP is Parkison's disease, an extremely popular
neuro-degenerative disease that affects roughly seven to ten million people worldwide.
Primer Design and Testing
Non‐disease forward primer (20 nt): 5’‐ TTAAGTGACTTGTACTTTGT
The primer test helps us detect a disease-associated DNA sequence. By locating the position of the disease-associated allele and its codon, both non-disease/disease, forward/reverse primers were created and tested in the UCSC In‐Silico PCR website. The results are shown below:
BME 100 Fall 2018
.png)
.png)
