PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl 2, and dNTP’s
DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette ps: only use each only once. Never reuse disposable pipette ps. If you do, the samples will become cross‐contaminated
Cup for discarded ps
Micropipette
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G2+
Positive control
none
G2 -
Negative control
none
G2 1-1
Patient 1, replicate 1
55505
G2 1-2
Patient 1, replicate 2
55505
G2 1-3
Patient 1, replicate 3
55505
G2 2-1
Patient 2, replicate 1
86299
G2 2-2
Patient 2, replicate 2
86299
G2 2-3
Patient 2, replicate 3
86299
DNA Sample Set-up Procedure
Extract DNA from the cell and move it to a special PCR tube.
Add Primer 1 to the PCR tube.
Add Primer 2 to the PCR tube.
Add nucleotides to the PCR tube.
Add DNA polymerase to the PCR tube
Place PCR tube into a DNA Thermal Cycler
Heat up to 95 degree Celsius
Cool Thermal cycler down to 50 degree Celsius so the thermal cycler changes to 72 degree Celsius
Repeat steps 1-8
OpenPCR program
Heated Lid: 100 degree Celsius. Initial Step: 95 degree Celsius for 2 minutes. Number of cycles: 25. Denature: at 95 degree Celsius for 30 seconds. Anneal: at 57 degree Celsius for 30 seconds. Extend: at 72 degree Celsius for 30 seconds. Final step: 72 degree Celsius for 2 minutes. Final hold: 4 degree Celsius
Research and Development
PCR - The Underlying Technology
PCR is used in molecular biology to make many copies of selected sections of DNA or a gene. Using PCR, we can make millions of copies of desired sections of DNA from a very small amount of DNA. PCR is used throughout medical and biological research studies. It is used for several reasons. It is used in early stages of processing of DNA, for detecting the absence or presence of a certain gene to help identify pathogens, and generating DNA profiles from small samples of DNA.
1. What is the function of each component of a PCR reaction?
Template DNA:
It is the DNA sequence that you want to copy.
Primers:
Primers attach to sites on the DNA strands that are at either end of the segment you want to copy. They are powerful tools for copying very specific DNA sequences since there is almost no chance that they will target the wrong sites.
Taq Polymerase:
Polymerase molecules act like tiny machines that read the DNA code and then attach matching nucleotides to create DNA copies. It can withstand the high heat in the PCR reaction.
Deoxyribonucleotides (dNTP’s):
Nucleotides are the A’s, C’s, G’s, and T’s that make up the DNA code. These genetic building blocks will be used to create billions of DNA copies.
2. What happens to the components (listed above) during each step of thermal cycling?
INITIAL STEP:95°C for 2 minutes:
Temperature is raised to be able to separate the strands.
Denature at 95°C for 30 seconds:
The DNA double helix separates, this creates two single-stranded DNA molecules.
Anneal at 57°C for 30 seconds:
Single stranded DNA molecules naturally attempt to pair up. However there are many more primer sequences then DNA strands in the tube. The primers crowd their way in and lock onto their target before strands can rejoin. The temperature is lowered so that the primers can attach.
Extend at 72°C for 30 seconds:
Temperature is raised slightly again to stimulate DNA polymerase to copy the strand. The DNA polymerase is activated. The DNA polymerase locates a primer attached to a single DNA strand it begins to add complementary nucleotides. This continues until it reaches the end of strand.
FINAL STEP: 72°C for 2 minutes:
72°C for 2 minutes: The DNA polymerase is stimulated to copy the strand. The products begin to appear two strands that begin with primer one and end with primer two. Twenty- two fragments that contain only target sequence and only ten longer sequences.
FINAL HOLD: 4°C:
Storing temperature is 4°C.
Q3. DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base‐pairing, driven by hydrogen bonding, allows base pairs to sck together. Which base anneals to each base listed below? If you need help, use the “Build a DNA Molecule” tool at hp://learn.genetics.utah.edu/content/begin/dna/builddna/
Adenine (A):
T
Thymine (T):
A
Cytosine (C):
G
Guanine (G):
C
4. During which two steps of thermal cycling does base‐pairing occur? Explain your answers.
Base-pairing occurs during the annealing and the extend steps. During the Annealing stage, the system is cooled and DNA primers are introduced to facilitate base-pairing. Then, the system is slightly warmed, during the extension phase, in order to activate polymerase and form the desired DNA strands.
SNP Information & Primer Design
Background: About the Disease SNP
Parkinson's disease is a nervous system disorder that progresses over time. It usually starts with small tremors and progressively gets worse over time. Parkinson's disease is caused by gene mutations such as LRRK2. Parkinson's disease affects the mid-brain which is in charge of the Central Nervous System. Even though there is no cure for Parkinson’s some advancements have been made such as using deep brain stimulation to stop tremors.
Primer Design and Testing
What is a nucleotide?
A nucleotide is a phosphate group bound to a nucleoside
What is polymorphism?
The presence of genetic variation within a population, upon which natural selection can operate.
What species is this variation found in?
Homo sapiens
What chromosome is the variation found on?
12:40315266
What is listed as the clinical significance of this SNP?
Uncertain significance
What condition is linked to this SNP?
Parkinson
What does LRRK2 stand for?
Leucine Rich Repeat Kinase 2
What is the function of LRRK2?
The functions of LRRK2 include ATP binding , GTP binding, and GTP-dependent protein kinase activity.
What is an allele?
An allele is one form of a gene that has multiple forms,most of which usually rise through mutation.
The disease associated allele contains what codone?
GAG is the codon that the disease-associated allele contains.
The numerical position of the SNP is:
40315266
Non disease foward primer (20nt):
5’- TTAAGTGACTTGTACTTTGT
The numerical position exactly 200 bases to the right of the disease SNP is:
BME 100 Fall 2018
