Name: Haley Strauss Role(s): Editor, OpenWetWare, Part A, Part B
Name: Richard Yan Role(s): Research, Definitions, Illustrator
LAB 4 WRITE-UP
Protocol
Materials
Lab coat and disposable gloves
PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2 and dNTP’s
DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross‐contaminated
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G6 P
Positive control
none
G6 N
Negative control
none
G6 1-1
Patient 1, replicate 1
77683
G6 1-2
Patient 1, replicate 2
77683
G6 1-3
Patient 1, replicate 3
77683
G6 2-1
Patient 2, replicate 1
34153
G6 2-2
Patient 2, replicate 2
34153
G6 2-3
Patient 2, replicate 3
34153
DNA Sample Set-up Procedure
Extracted DNA and placed it in the PCR tube
Add Primer 1 to the PCR tube
Add Primer 2 which will attach to the second site
Add nucleotides to the PCR tube
Add DNA Polymerase to the PCR tube
Place the PCR tube into a DNA Thermal Cycler
Start the Thermal Cycler
Set the temperature of the heated lid to 100℃
Add an initial step setting the temperature to 95℃ for 2 minutes
There should be 25 cycles denaturing at 95℃ for 30 seconds, annealing at 57℃ for 30 seconds, and extending at 7℃ for 30 seconds
Keep the temperature at 72℃ for 2 minutes
The final hold should be held at 4℃
OpenPCR program
To run a PCR, the computer program must be set up.
Connect the OpenPCR program to a computer with a USB cable
Turn on the program and open the app
The heated lid must be set up to eliminate condensation during the lab.
Open the PCR lid by twisting the black lid knob counterclockwise and place multiple empty PCR tubes.
Close the lid by twisting the same knob clockwise. When the lid is at the proper height, the front of it will begin to rise.
Run a few cycles with one PCR tube containing a drop of water. This step assures that little to no condensation will take place.
After the heated lid is set up once, it does not need to be readjusted until a new type of PCR tube is added
Adding, deleting, and holding steps in a PCR lab
The default temperature of the lid is 110℃ and can be changed to different temperatures for each steps
Add each step that the PCR reaction will undergo (example: Denaturing, annealing, extending, etc.) with each of its temperatures and set the number of cycles that will be done.
For a table that looks like this: PCR Components at Each Step and Cycles
Function of PCR Components Template DNA acts as a template for DNA polymerase to attach to and begin adding base pairs to. Primers, which are short pieces of DNA that are made in the laboratory, act as a starting place on the template DNA for the DNA polymerase to attach to and add nucleotides. Taq Polymerase attaches to template DNA to copy DNA. It is unlike regular polymerase because it does not break down and can operate in high temperatures. Deoxyribonucleotides are monomer of single units of DNA that is comprised of a nitrogenous base, a deoxyribose sugar and one phosphate group.
What Happens to the Components During Each Step?
To begin a polymerase chain reaction (PCR), the PCR tube containing DNA, primers, nucleotides, and polymerase is heated at 95℃ for approximately two minutes to begin separating the DNA helix into two individual strands. For the next thirty seconds, the temperature is kept at 95℃ to denature the DNA. The temperature is lowered to 57℃ so the strands can begin to pair again; however, primers attach first which blocks the DNA from completely rejoining. The temperature is raised to 72℃ for 30 seconds to activate the polymerase. It is kept at that temperature for two more minutes, so that the DNA polymerase can add nucleotides to the single strand of DNA. These steps are repeated multiple times to create many copies of the target DNA. The last step is to lower the temperature to 4℃. Learning Genetics
Nucleotides
Adenine and thymine bind together via hydrogen bonding. Cytosine and Guanine bind together. DNA
Thermal Cycling and Base Pairing
Base pairing occurs during the anneal step, when the PCR tube is cooled to 57℃, and the extension step, when the PCR tube is heated to 72℃. During the anneal step, the primers attach to the DNA which blocks the individual strands from completely rejoining. During the extension step, DNA Polymerase adds individual nucleotides to the single DNA strands. These nucleotides (A,T,G,C) bind to the other nucleotides on the single strand of DNA.
SNP Information & Primer Design
Background: About the Disease SNP
A nucleotide is the basic unit of nucleic acids that consists of a nucleoside attached to a phosphate group. It forms the basic structural unit of nucleic acids such as DNA. Polymorphism is the presence of a different number of alternative forms within a protein or nucleic acid. A single nucleotide polymorphism (SNP) is linked to Parkinson's disease. The clinical significance of a single nucleotide polymorphism is uncertain. It is found in the twelfth chromosome in homosapiens.
Primer Design and Testing DNA Sequence
CTGCAGTTAAGTGACTTGTACTTTG[A/T]GGAACCCAAGTGGCTTTGTAAAATC
Leucine Rich-Repeat Kinase 2 (LRRK2) performs the functions of ATP binding, GTP binding, and SNARE Binding. It provides instructions for making a protein called dardarin, a protein that was active in the brain and other tissues of the body. When it is affected by a change in a single nucleotide, the function of LRRK2 can change. An allele is two or more alternative forms of a gene that arise by mutation and are found in the same place on a chromosome. The allele that is associated to the disease is allele T.
The numerical position of the SNP is 40,315,266. The non-disease forward primer is 5’-TTAAGTGACTTGTACTTTGT-3’. To find the non-disease reverse position, the reverse 20 bases of the bottom strand are recorded from a position 200 bases away. The numerical position exactly 200 bases to the right of the disease SNP is 40,315,466. The non-disease reverse primer (20 nt):5’-TGAAGCTCTTCAAGTAGTCT-3’. The disease forward primer is 5’-TTAAGTGACTTGTACTTTGA-3’ and the disease reverse primer is 5’-TGAAGCTCTTCAAGTAGTCT-3’.
Gene View of the PCRNCBI SNP Gene View of the PCRUCSC
References
“Build a DNA Molecule.” Genetic Science Learning Center, University of Utah, learn.genetics.utah.edu/content/basics/builddna/.
“PCR Virtual Lab.” Genetic Science Learning Center, University of Utah, learn.genetics.utah.edu/content/labs/pcr/.
“Reference SNP (RefSNP) Cluster Report: rs721710** With Uncertain Significance Allele **.” National Center for Biotechnology Information, U.S. National Library of Medicine, www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=721710.
BME 100 Fall 2018
