PCR reaction mix, 8 tubes, 50μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP's
DNA/ primer mix, 8 tubes, 50μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer.
A strip of empty PCR tube
Disposable pipette tips
Cups for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G8 +
Positive control
none
G8 -
Negative control
none
G8 1-1
Patient 1, replicate 1
39480
G8 1-2
Patient 1, replicate 2
39480
G8 1-3
Patient 1, replicate 3
39480
G8 2-1
Patient 2, replicate 1
81770
G8 2-2
Patient 2, replicate 2
81770
G8 2-3
Patient 2, replicate 3
81770
DNA Sample Set-up Procedure
Label the test tubes as G8 P, G8 N, G8 1-1, G8 1-2, G8 1-3, G8 2-1, G8 2-2, G8 2-3.
Start by distributing the DNA into the PCR tubes.
Next, put primer 1 into the PCR tubes.
Then, put primer 2 into the PCR tubes.
Next, put the nucleotides into the PCR tubes.
Then, transfer the DNA polymerase into the PCR tube.
Next, put the PCR tubes into the thermocycler.
Follow the OpenPCR Program steps below.
OpenPCR program
The lid should be heated to: 100°C.
The initial hold should be: 95°C for 2 minutes.
There are 25 cycles set as follows:
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds.
In the final step it will be: 72°C for 2 minutes.
And the final hold will be: 4°C.
Research and Development
PCR - The Underlying Technology
Function of Components
There are four major components in a PCR reaction with specialized functions that allow the PCR reaction to occur properly. These four components are template DNA, primers, taq polymerase, and deoxyribonucleotides, or dNTPs for short. The first, and probably most important component of the PCR reaction is the template DNA. The template DNA provides the desired DNA sequence to be copied during the reaction; it is essentially the blueprint for the whole reaction. The second component of the PCR reaction is the primers. These primers are specifically designed to attach to the specific desired section of the template DNA. Their purpose is to provide a location for the taq polymerase to attach so that it may begin copying the DNA. In the reaction, two different primers are designed and used; one primer attaches to the top DNA strand, while the second primer attaches to the bottom of the DNA strand. The third component of the reaction is the taq polymerase. As previously mentioned, the taq polymerase attaches to the primers and begins copying the desired section of the template DNA by adding the proper nucleotides from the surrounding environment. The fourth and final component of a PCR reaction is the deoxyribonucleotides, or dNTPs. These dNTPs make up DNA molecules, and without them, it would be impossible for taq polymerase to properly copy the template DNA. Overall, each of the four components of a PCR reaction have an important function that is integral to the reaction.
PCR Steps
The PCR reaction has several steps that follow specific temperature and time constraints to allow for the DNA to be replicated as efficiently as possible. During the initial step, the thermocycler is heated to 95℃ for two minutes. Next, the thermocycler is held at 95℃ another thirty seconds which causes the template DNA to begin to denature. As the DNA denatures as a result of the intense heat, its double-helix separates into two single-stranded DNA molecules. This new single-stranded structure will allow the taq polymerase to copy the DNA later in the PCR reaction. After the DNA has been denatured, the thermocycler is cooled to 57℃ for thirty seconds. During this step, the two primers attach, or anneal, to each of the DNA strands before the DNA is able to reform its initial double-helix structure. After this annealing step, the thermocycler is heated back up to 72℃ for thirty seconds. This quick increase in temperature activates the taq polymerase, and the polymerase begins attaching to the primers and adding nucleotides to the DNA strand. This step is known as the extension step. Upon completion of this step, the denaturing, annealing, and extension steps are repeated a predetermined number of times, in this case they will be completed twenty-five times. Once those three steps have been completed the set number of times, the thermocycler is held at 72℃ for another two minutes to ensure that the taq polymerase has successfully finished replicating all of the DNA strands. Finally, the thermocycler is cooled and held at 4℃. This important final step allows all of the DNA strands to recombine and reform its normal double-helix structure. After the DNA has reformed the double-helix structure, the PCR reaction has been completed, and the results are millions of copies of the template DNA.
Base Pairing
DNA is composed of four different types of nucleotides: adenine (A), thymine (T), cytosine (C), and guanine (G). Base-pairing is an important concept in regards to DNA as it describes which base pairs will stick together in DNA. The adenine and thymine bases stick together, and the cytosine and guanine bases stick together; however these are the only combinations that properly anneal in DNA. In a PCR reaction, the base-pairing occurs during both the annealing and extension steps. During annealing, the system is cooled so that the template DNA will base-pair with corresponding primers that serve as a starting position for the replication of the template DNA. In the extension step, the temperature is increased, and the taq polymerase activates and attaches to the primers that are bound to the template DNA. The taq polymerase then starts replicating the template DNA by using base-pairing to add the proper nucleotides to the strands of template DNA. Overall, base-pairing is integral to the process of a PCR reaction, specifically during the annealing and extension steps, as it allows the template DNA to be replicated.
SNP Information & Primer Design
Background: About the Disease SNP
To begin with, SNP stands for single-nucleotide polymorphism. It can be defined as a difference or variation at a single base pair in the genome. Since DNA is constantly being copied into making new cells, SNPs are very common in everyone. In fact, SNPs show up in every 300 nucleotide's which mean there are about 10 million SNP's in the human genome. Unfortunately, some SNPs are associated with certain diseases.
The SNP block that was investigated was rs721710. This chromosome is located in 12:40315266, this SNP variation is most commonly found in humans. This particular SNP location in a non-diseased allele would correctly be codons- GTG but in a diseased allele it would be codons- GAG, the disease associated with this change in positions would be Parkinson's disease. The variation is found in the gene, LRRK2, which stands for leucine rich repeat kinase. Its most important functions includes ATP binding and GTP binding.
Primer Design and Testing
The non-disease primers tested included the forward primer (5'TTAAGTGACTTGTACTTTGT) and the reverse primer (5'TGAAGCTCTTCAAGTAGTCT). To validate these primers, both were entered in a non-disease genome sequence website. As a result, it showed a 220 bp sequence from the chromosome rs721710. Thus, proving the primers worked since the forward non-disease primer began 20 bases before the position of the SNP disease and the reverse non-disease primer 200 bases to the right of the disease SNP. Moreover, when the disease-specific primers were entered in the site, it resulted in "no matches" because these are the primers that carry the disease. Thereby, they will not be found in a non-disease genome sequence.
BME 100 Fall 2018
