BME100 s2014:T Group12 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Company: GMP (Genetics Made Possible) Our Product: The Green Machine LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a design software that allows a person to create a 3-D model of anything they need/want to. We used this program to model the sides of the original PCR machine so as to determine a new model for it. The new model using this program provides a new perspective on an older idea. Our Design For the inside of the machine, the grey box is the automated portion, the green and white ledge is the slide and retractable mount, the blue lump is the LED light that turns on when the slide mount is extended, the blue box is the thermocycler, the orange box is the microcamera mount, and the red box is a sample container, or"Self-Contained Green Magazine" (see below). For the outside of the machine, one hinged panel is used to allow camera mounting, one hinged panel is used to allow the tray to be placed, and one small slit was made to allow slide to be inserted/removed. Our design uses an automated system within the machine that tests the materials that are input. Each section of the machine allows for easy access to the machine, but no light to access the inside of the machine, where the results are obtained. This design allows for the materials and solutions to be previously gathered into a container, or "Self-contained Green Magazine", to be inserted into the machine. Furthermore, the machine will prepare the necessary solutions for the PCR test, automate the PCR and fluorimetery tests, and generate the pictures and results independent of user labor, so that error is minimized, results are accurate, and the user is not required to be fully occupied by the test. Besides the automated system, it has the same processes as the original PCR machine and original fluorimetery test, but in a much more contained environment, involving much less room for error, and having freed up time for the user due to the practicality of being automated. Feature 1: Disease SNP-Specific Primers Background on the disease-associated mutation The single nucleotide polymorphism rs237025 is related to type one diabetes. which is the disease we have sequenced a primer for. The genes associated with this disease are SUM04 and TAB2. These genes have mutations in them that have been found to cause Type one diabetes. Due to a polymorphism of the nucleotides. Type one diabetes is found in Homo Sapiens located on the chromosome 6:149721690. The gene SUMO4 stands for Type 2 diabetes mellitus. This family of genes encodes a small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability, or activity. The point mutation is at the allele of one of the bases. The non-diseased allele contains GTG. A change in this allele, at the first G position, is linked to the disease. The disease-associated allele contains the sequence ATG. Primer design To design a disease sequence-specific primer pair. We looked at the DNA sequence that is 20 bases long and ends with the nucleotide from the disease-associated allele, which is 5’ TGAACCACGGGGATTGTCAA, this is our forward primer. Located in the numerical position on the DNA strand at 149721690. For the reverse primer we look 200 bases to the right of the disease SNP at numerical position 149721890. The reverse primer will be on the bottom strand and read from the 5 prime end as well. The reverse primer is 5’ TGTGGTGGAACCAAATTGCA. Disease SNP-specific Forward Primer: TGAACCACGGGGATTGTCAA Reverse Primer: TGTGGTGGAACCAAATTGCA How the primers work: This is done to detect the disease and also have as a control in the test to ensure accuracy. The reverse primer will bind to the DNA 100% of the time (both not diseased and diseased DNA sequences). when this happens the DNA will not exponentially amplify. For the case of a not diseased DNA sample the test will render minimal amplification. If the reverse primer does not bind to the DNA sequence then the test is considered to be a not valid. The forward primer will only bind to the diseased DNA sequences along with the forward primer. This will result in an exponentially amplified DNA that contains the disease-associated SNP. Feature 2: Consumables Kit Self-contained Green Magazine Contents of the magazine: 1. PCR reaction mix (containing Taq DNA polymerase, MgCl2, and dNTP's) 2. Primer mix 3. Positive DNA 4. Negative DNA 5. Subject DNA 6. SYBR Green I dye 7. Disposable pipette tips 8. Test tubes 9. Rough superhydrophobic slides All of these items will be loaded into a container, or "magazine." There will be specific compartments for the different types of items. One side of the magazine will have compartments for the more generic items, including: PCR reaction mix, SYBR Green I dye, disposable pipette tips, test tubes, and rough superhydrophobic slides (for the fluorimetery test). The other side of the magazine will have compartments for items more specific to the test, including: positive DNA, negative DNA, and subject DNA. Additionally, there will be a compartment which houses a compartment that will collect the disposable pipette tips and the other used items when they are ready to be disposed of. All of these items, generic and specific, will be in their own container when inserted into the magazine. The magazine will be such that it slides into the Green Machine. Inside the Green Machine, a simple automated robotic system will prepare solutions using the items in the magazine and it will also move the prepared solutions to their proper compartment for PCR and fluorimetery testing. This way of packaging the consumables creates a more organized method of performing PCR and fluorimetery. Instead of having a researcher working with multiple solutions scattered around, this system is more contained and controlled, which helps speed up the testing process and reduce contamination. This packaging method helps eliminate human error as well. Feature 3: Hardware - PCR Machine & Fluorimeter Included in the Green Machine will be the PCR machine and fluorimetery system along with the simple automated robotic system that prepares solutions, transports them, and tests them. Both the PCR machine and fluorimetery system will be integrated into the Green Machine so that they can be controlled by the Green Machine's computer. Both the PCR thermal cycler and fluorimeter system will be above the inserted magazine and on opposite sides of the Green Machine. Fluorimeter Redesign A weakness of the original fluorimeter was that it required a movable smartphone with a camera. This is an unwanted variable for detecting the amount of green light produced. To improve the system, a mounted camera will be attached to the fluorimeter system. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach The PCR results can sometimes be misleading and it is better not to rely entirely on it to predict whether a person has cancer or not because in the PCR results it showed an either positve or negative response.This will cause cancer misdiagnosis as a patient who doesn't have cancer may think he has it while a patient who has cancer may think he doesn't have cancer and will never have cancer.The Bayesian statistics verifies that the fact that you are tested positive to cancer doesn't mean you have it, it is probable you may develop the disease and the fact that a patient is tested negative to cancer doesn't mean he will never get cancer.So the Bayesian statistics uses a very logical interpretation to tell you an accurate probability of developing cancer after you have been tested positive.Calculation 3 and 4 shows that a person who has tested positive may have a lower probability of developing cancer while a person who has been tested negative may have a higher probability of developing cancer.This makes sense because the fact that a person has family history of cancer doesn't mean he is going to get cancer.People with no family history of cancer also develop cancer.