DNA/primer mix, 8 tubes, 50 μL each: each mix contains a different template DNA. All tubes have the same forward and reverse primer
A strip of empty PCR tubes
disposable pipette tips: only use each only once. Never reuse disposable pipette tips or samples will be cross contaminated.
A cup for discarded tips
Micropipetttor
Open PCR machine; shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G15 +
Positive control
none
G15 -
Negative control
none
G15 1-1
Patient 1, replicate 1
43290
G15 1-2
Patient 1, replicate 2
43290
G15 1-3
Patient 1, replicate 3
43290
G15 2-1
Patient 2, replicate 1
40691
G15 2-2
Patient 2, replicate 2
40691
G15 2-3
Patient 2, replicate 3
40691
DNA Sample Set-up Procedure
Step 1: Gather all of the materials needed for the experiment
Step 2: Label all of the tubes accordingly: G151-1, G151-2, G151-3, G151-3, G152-1, G152-2, G152-3, G15P, and G15N. The labels indicate the trials for patient one (G151-1, G151-2, and G151-3), patient two (G152-1, G152-2, and G152-3), positive control (G15P), and negative control (G15N).
Step 3: Using a new disposable pipette tip, add the DNA samples for patient one to the corresponding tube using a micropipette. Dispose of the pipette tip.
Step 4: Repeat step 3 for each DNA samples using a new disposable pipette tip.
Step 5: Add 50 of the PCR reaction mix to all of the 8 tubes.
Step 6: Add 50 of the DNA/primer mix to all of the 8 tubes.
Step 7: Place the tubes into the PCR thermal machine using the information below.
OpenPCR program The following values are given for the thermal cycling program to run 25 cycles of PCR.
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
Each Cycle consists of:
Denature at 95°C for 30 seconds
Anneal at 57°C for 30 seconds
Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
What is the function of each component of a PCR reaction?
The DNA template is the sample of DNA that contains the targeted genome sequence. By subjecting the original double-stranded DNA molecule to high temperatures the strands can be separated. The primers are short pieces of single-stranded DNA that are complementary to the target sequence found in the DNA template. Taq DNA polymerase is a type of enzyme that synthesizes new strands of DNA complementary to the target sequence. Deoxyribonucleotides (dNTP’s) are single units of the bases A,T,G, and C, which are the components necessary for creating new DNA strands.
What happens to the components (listed above) during each step of thermal cycling?
PCR Thermal Cycling process has 5-6 main steps for one main cycle of replication. First Step is to set the thermal cycler in 95 degrees celsius for 3 minutes before DNA is set so the DNA is immediately put into the heated environment. Second Step is main separation of the DNA into single strands through heat denaturation; the the final mixed tube is placed into the thermal cycler that is set to 95 degrees celsius for 30 minutes. Third step is the annealing process where the primers are attached to the separated DNA at the specific locations of the primers. The temperature of the thermal cycler decreases to 57 degrees celsius for 30 minutes to cool the DNA for the annealing process. Fourth step is the extension process at the location of attached primers using the enzyme DNA Polymerase which is activated when the temperature is raised to a specific temperature of 72 degrees for 30 minutes celsius and base pairs are attached to the new strand starting from the primers and are attached until Polymerase reaches the end of the strand. Fifth step is the final step for replicating one cycle of the DNA strands where the thermal cycler is continued to be at 72 degrees celsius for 3 minutes. The final hold will be at 4 degrees celsius when the thermal cycler has completed multiple cycles.
DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base Pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below?
DNA is formed from four different nucleotides: Adenine (A), Thymine (T), Cytosine (C), and Guanine (G). Since DNA is a double helix formed by two template strands of DNA, each nucleotide contains a base pair to which it bonds to by hydrogen bonding. Adenine and Thymine are base pairs. Cytosine and Guanine are base pairs.
Adenine (A):Thymine(T)
Thymine(T):Adenine(A)
Guanine(G): Cytosine(C)
Cytosine(C):Guanine(G)
During which two steps of thermal cycling does base pairing occur?
During thermal cycling, the steps in which base pairing occurs are the Anneal and Extend steps. In step 3, the anneal process consists of the attaching of primers to the two DNA strands. Since a primer can only attach to their corresponding nucleotide, this step contains base pairing. In the second strand when the temperature increases, the Extend process begins. In this step, DNA Polymerase attaches to the DNA strand and begins add the corresponding nucleotides to the template DNA strand. In the end, the single DNA strands formed are once again double strands of DNA. Therefore, this step also contains base pairing for the nucleotides added at each point are the base pairs of the one on the DNA strand.
SNP Information & Primer Design
Overview of Data: Part I:
Nucleotide: A nucleotide is a building block of DNA and RNA composed of a molecule of sugar, a phosphoric acid, and a base ( adenine, thymine, guanine, or cytosine).
Polymorphism: The occurrence of two or more different phenotypes within the population of a species. (i.e. Normal jaguar vs. Black jaguar)
Species that has variation: Homo sapiens Chromosomes: 19:17811986 Clinical significance: N/A Genes: B3GNT3 Disease linked to this SNP: non-Hodgkin lymphoma
Allele:A variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome.
Disease associated allele:
CAC
Position:
17811986
Part III:
Numerical Position 200 bases to the right:
17812186
Non-Disease Forward Primer:
5’ GTG CGG GCT CCA TCG CAA CG 3’
Non-Disease Reverse Primer:
5’ GGA GGA AGG TGT CGC CCC TT 3’
Disease Forward Primer:
5’ GTG CGG GCT CCA TCG CAA CA 3’
Disease Reverse Primer:
5’ GGA GGA AGG TGT CGC CCC TT 3’
Background: About the Disease SNP
Single nucleotide polymorphisms, SNPs are the most common type of genetic variation among people. The mustate human gene is B3GNT3 is affected by a SNP in chromosome 19; this point mutation results in an allele codon change from CGC to CAC. This mutation can occur at different positions depending on the person. And the codon change results in a change of protein during translation where an arginine is substituted by a histidine in the final amino acid chain. Thus, a mutation in the protein results in a missense— a single nucleotide change results in a codon that codes for a different amino acid— and greatly affects the original function of the protein. As shown above the non-disease chain performs three main functions as listed previously N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity, beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity, and galactosyltransferase activity. All in all, this mutation in the genome has been observed to lead to a risk of Non-Hodgkin lymphoma.
Primer Design and Testing
In distinguishing the non-disease/non mutated SNP from the disease/mutated SNP, 4 different primers will be need:
All primers were designed with a length 20 nt.
The forward primer for the non-disease SNP, GTGCGGGCTCCATCGCAACG.
The reverse primer for the non-disease SNP, GGA GGA AGG TGT CGC CCC TT.
The forward primer for the disease SNP, GTGCGGGCTCCATCGCAACA.
The reverse primer for the disease SNP, GGAGGAAGGTGTCGCCCCTT.
It is important to note that the reverse primer, GGAGGAAGGTGTCGCCCCTT, is shared by both sequences and begins 200 bases from the SNP.
Using this information input the sequences into the UCSC In-Silico PCR web tool. And the results are a match to the 19th chromosome:
BME 100 Spring 2016
