BME100 s2017:Group7 W1030AM L4

BME 100 Spring 2017	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Avery Cartwright Name: Angelica Garrido Name: Brianna Lopez Name: Jason Reyes LAB 4 WRITE-UP Protocol Materials Lab Coat and disposable gloves PCR reaction mix, 8 tubes, 50 µL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP's (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorl ess-master-mix-m714-protocol/) DNA/ primer mix, 8 tubes, 50 µL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse prime Strip of empty PCR tubes Disposable pipette tips: only use each only once. Cup for discarded tips Micropipettor Open PCR machine PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G7 + Positive control none G7 - Negative control none G7 1-1 Patient 1, replicate 1 91754 G7 1-2 Patient 1, replicate 2 91754 G7 1-3 Patient 1, replicate 3 91754 G7 2-1 Patient 2, replicate 1 99764 G7 2-2 Patient 2, replicate 2 99764 G7 2-3 Patient 2, replicate 3 99764 DNA Sample Set-up Procedure All materials were collected. Empty PCR tubes were cut in half so that there are four linked tubes in two strips. The tubes were labeled by a black marker as in the above chart. The tubes were then placed in a tube rack. Using a pipette, 50μL of PCR reaction solution was transferred into the empty positive control tube. (A new pipette tip was used for each step) 50μL of positive control DNA/primer solution was pipetted into the positive control tube. Steps 5 and 6 were then repeated for the negative control, patient 1 replicates 1, 2, and 3, and patient 2 replicates 1, 2, and 3. The lids of the PCR reaction tubes were closed completely and tightly. The tubes were then placed into the slots of the heating block of the group assigned thermal cycler PCR machine. OpenPCR program PCR Thermal Cycling cite: http://image.made-in-china.com/4f0j00iBNTKjhqnIrz/PCR-25-PCR-Thermal-Cycler http://perlong.en.made-in-china.com/ Heated Lid: 100°C Initial Step: 95°C for 2 minutes Number of cycles: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds Final Step: 72°C for 2 minutes Final Hold: 4°C Research and Development PCR - The Underlying Technology Functions of Each Component: The function of the template DNA of a PCR reaction is to allow the primers to match to it and is the segment of DNA that is going to be copied. The function of the primers is to signal where the DNA polymerase is to attach and begin copying the DNA template. The function of the taq polymerase is to break down and separate the two DNA strands because it can survive the high temperature of the process. The function of the deoxyribonucleotides (dNTP's) is to attach to the end of the primer to copy the DNA template and make new DNA strands. Steps of Thermal Cycling: During thermal cycling some DNA, dNTP's, DNA polymerase, and primers to the PCR tube, and then placed into the DNA Thermal Cycler. For 3 minutes the temperature is set to 95°C for 3 minutes. At this step it is warming up, almost boiling, and the DNA is getting ready to separate its strands. At 95°C for 30 seconds the DNA starts to denature, meaning that it is separating and as a results makes two single-stranded DNA molecules. At 57°C for 30 seconds, a single stranded DNA molecules naturally attempt to pair up. The primers crowd up and lock to a target before strands can rejoin. At 72°C for 30 seconds The DNA polymerase is activated. When the polymerase finds a primer attaches to a single DNA strand it begins to make a complementary nucleotides on the strand. At the final step for 3 minutes it is set to 72°C, where it goes on until it reaches the end of the strand and falls off. A final hold can be placed at 4°C and this is used to limit the activity of Taq DNA polymerase sot this can prevent potential non-specific binding of primers. cite: http://learn.genetics.utah.edu/content/labs/pcr/ Nucleotide Pairing: Adenine (A):T Thymine (T):A Cytosine (C):G Guanine (G):C Where Base-Pairing Occurs: Base-pairing happens between the steps of Annealing and Extending. At annealing the temperature is at 57°C. At this step the primer attaches to the separated DNA strands. At the extending stage the temperature is at 72°C. This lets the DNA polymerase attach to the primer. Then, the DNA polymerase begins to make complementary nucleotides on the strand. SNP Information & Primer Design Background: About the Disease SNP A SNP is a single nucleotide polymorphism. A nucleotide is a basic structural unit of nucleic acids. Polymorphism describes the variety that nucleotides can have in a singular strand. In this lab, we are looking into the disease related SNP. Disease SNP are nucleotides that cause illness from their creation. Specified SNP SNP: rs121908757 This is variation of SNP is found in humans, Homo sapiens. Within humans, the seventh chromosome is where it is located. This SNP is pathogenic, disease causing, linking it to cystic fibrosis and sever cardiac impact. Being called CTFR or, Cystic fibrosis transmembrane conductance regulator, creates a protein that makes a channel across the membrane of cells that produce mucus, sweat, saliva, tears, and digestive enzymes. Terms associated with CTFR, such as, PDZ domain binding, intracellular ATPase-gated chloride channel activity and protein binding, describe where CFTR has its effect on. Going into more detail, an allele is variant gene created by codons. what causes a problem is when a mutation occurs to a specific allele,"AGT", where the A is switched with a C. This SNP is located numerical on position 117,587,799. Primer Design and Testing For the primer design, we will need the 20 codons that come before SNP location, having the last one being the change. In this case, the primer would be 5'- AGAAGGTGGAATCACACTGA .For the PCR process, we need reverse primer, which we create by going 200 codons past the location position of the mutation, in this case, 117,587,999. For the Reverse primer, it would be 5'- CATTATTTATAGTTCTTAAA. Now, we would need to pair this with the disease primers. Now to create these, we only need to change the last codon of the first primer into the disease causing mutation. we also keep the reverse primer the same. We validate these primers and with confirmation, the primers are done at last.