C5.0 Partial Oligo Order Form

From OpenWetWare

Jump to: navigation, search
PlateRowColumnName5\' Mod(Ensure sequences are in ALL CAPS)3\' ModComments
box_v5_AA01c5.0.1.1TAAAGTATAGCATT
box_v5_AA02c5.0.1.2AAGTCAGAGGGTAATTGAGCGAAACCGAGGAAACGCTGGCAT
box_v5_AA03c5.0.1.3GATTAAGTCTACTAATAGTAGCGGTGTCTGGAAGTATGCTGT
box_v5_AA04c5.0.1.4AGCTCAAAAAGACTTCAAATAAGCAAAGCGGATTGGTAATAG
box_v5_AA05c5.0.1.5TAAAATGAGGCAAGTCCGCTACGTATAAGGCGCTCACAATTC
box_v5_AA06c5.0.1.6CACACAAGCCAGCTGCATTAAGGTAGAAAGATTCATACCAGT
box_v5_AA07c5.0.1.7CAGGACGTTGGGAAGAAAAATACAAAGCTGCTCATATCCCTT
box_v5_AA08c5.0.1.8ACTAAATGTGGCGAGAAAGGAAGGCCGATTAAAGGGAGGCCA
box_v5_AA09c5.0.1.9CCGAGTATCCAGAACAATATTCTCAATCGTCTGAAACAGACA
box_v5_AA10c5.0.1.10ATATTTTAAAAATACCGAACGAACCACCAGCAGAAAAGCATC
box_v5_AA11c5.0.1.11ACCTTGCCTTGATACCGATAGTTTTTCACGTTGAAAATCTCC
box_v5_AA12c5.0.1.12AAAAAAATCCAGACGTTAGTACCACCAGAAGGAGCCTGATTG
box_v5_AB01c5.0.1.13TTTGGATTATACTTCTGAATACGTCAGATGAATATCCGCCAC
box_v5_AB02c5.0.1.14CCTCAGACCAGGCGGATAAGTTGCCTATTTCGGAATACATGG
box_v5_AB03c5.0.1.15CTTTTGATCAGACGATTGGCCCCCTCAGAACCGCCTCGGTCA
box_v5_AB04c5.0.1.16TAGCCCCGGCTTATCCGGTATCCAGTTACAAAATAAACAGCC
box_v5_AB05c5.0.1.17ATATTATGCAGCCTTTACAGAACCGTCACCGACTTTTTTGTC
box_v5_AB06c5.0.1.18ACAATCAATAGAAAATTCATAAGTATGTTAGCAAACAGATAG
box_v5_AB07c5.0.1.19CCGAACAGCAATAAAGCCTCAGAGCATAAAGCTAATATTTCA
box_v5_AB08c5.0.1.20ACGCAAGTGATATTCAACCGTTAGCATGTCAATCATAAATCA
box_v5_AB09c5.0.1.21GCTCATTCAGCTTTCATCAACTCTGCCAGTTTGAGACCGCTT
box_v5_AB10c5.0.1.22CTGGTGCCAAGGCGATTAAGTTGGGTAACGCCAGGCGACGGC
box_v5_AB11c5.0.1.23CAGTGCCATTCATTGAATCCCATAGTAAGAGCAACACTATCA
box_v5_AB12c5.0.1.24TAACCCTGGAATACCACATTCCCCGCTTTCCAGTCAGCTGAT
box_v5_AC01c5.0.1.25TGCCCTTCACCGCCTGGCCCTCTGGTTTGCCCCAGTAGTAAA
box_v5_AC02c5.0.1.26TTGGGCTCAGATGAACGGTGTCAATCATAAGGGAAAAAAGAA
box_v5_AC03c5.0.1.27TACACTATAATGCCACTACGACTGAGGCTTGCAGGACAACAA
box_v5_AC04c5.0.1.28CCATCGCTGAGAGCCAGCAGCGACAACTCGTATTAAATCCTT
box_v5_AC05c5.0.1.29TACTTTTGCGGGAGAAGCCTTATCGGTTGTACCAATACCGAA
box_v5_AC06c5.0.1.30AATCCAACCCAATAGCAAGCAGCAAGCCGTTTTTACGCCTGT
box_v5_AC07c5.0.1.31TTATCAACAATAGATAAGTCCAGTAATTCTGTCCACCTCAGA
box_v5_AC08c5.0.1.32TTACCGTTACTAGAAAAAGCCATAGGTCTGTCCAATCGCAAG
box_v5_AC09c5.0.1.33ACAAAGAGCGATAGCTTAGATGGTTTTGCTCAGTAACCGCCA
box_v5_AC10c5.0.1.34CCCTCAGAACACTGAGTTTCGATGGGATTTTGCTATTGCGAA
box_v5_AC11c5.0.1.35TAATAATTTGCGCCGACAATGGAGTTAAAGGCCGCTTGGCAG
box_v5_AC12c5.0.1.36ATTCACCACTCAAACTATCGGCCTTGCTGGTAATAAAAGAGT
box_v5_AD01c5.0.1.37CTGTCCAGACCCCCAGCGATTTACTTAGCCGGAACGAGGCGC
box_v5_AD02c5.0.1.38AGACGGTACAGACCAGGCGCAAAGGAGCGGGCGCTAAATCAA
box_v5_AD03c5.0.1.39GTTTTTTGGGGTCGAGGTGCCACTATTAAAGAACGGTTTGAT
box_v5_AD04c5.0.1.40GGTGGTTGTGAGACGGGCAACGGGAAACCTGTCGTCATACGA
box_v5_AD05c5.0.1.41CAGGCAAAGCGCCATTCGCCAGTGTAGATGGGCGCCTATTAT
box_v5_AD06c5.0.1.42AGTCAGATCGCGTTTTAATTCGAGCTTCAAAGCGAATGGCTT
box_v5_AD07c5.0.1.43AGAGCTTCATTAAATTTTTGTTATGTACCCCGGTTGATAATC
box_v5_AD08c5.0.1.44AGAAAAGGCCGGAGACAGTCAAAGGTGGCATCAATACTCCTT
box_v5_AD09c5.0.1.45ATTACGCTGGTTTACCAGCGCGGAAATTATTCATTATCGATA
box_v5_AD10c5.0.1.46GCAGCACTTTCATCGGCATTTACCCTCAGAGCCACGAGAATA
box_v5_AD11c5.0.1.47TAAAGTATTGAGAATCGCCATATTTAACAACGCCAATACCGA
box_v5_AD12c5.0.1.48CCGTGTGACTGGTAATAAGTTAGTGCCCGTATAAACAGTTAA
box_v5_AE01c5.0.1.49TGCCCCCGCCGTCGAGAGGGTATTTTCCCTTAGAAGGAAACA
box_v5_AE02c5.0.1.50GTACATAAATCAATATATGTGTTTGAATACCAAGTTTTTACA
box_v5_AE03c5.0.1.51TCGGGAGTCATCAATATAATCGGAATTATCATCATGTTGAAA
box_v5_AE04c5.0.1.52GGAATAACAAACCCTCAATCAAAAACATCGCCATTTGAATGG
box_v5_AE05c5.0.1.53CTATTAGTCTTTAA
box_v5_AE06c5.0.1.54TATTTTTGATAATCGTAAAACTCTAGCTGATAAATATAACCT
box_v5_AE07c5.0.1.55GTTTAGCACATAAAGGTGGCAACGGAATAAGTTTAGAGCCAT
box_v5_AE08c5.0.1.56TTGGGAAACCATTACCATTAGCCATCTTTTCATAAACCGGAA
box_v5_AE09c5.0.1.57ACGCTCAACCGGAATCATAATTCCAGTAAGCGTCACCTATTA
box_v5_AE10c5.0.1.58TTCTGAAACATGAAAGTATTAATTAGGATTAGCGGTAAGACG
box_v5_AE11c5.0.1.59CTGAGAATTAATTACATTTAACAATTTCATTTGAAATTTCAA
box_v5_AE12c5.0.1.60TTACCTGATTTTCAGGTTTAAATGGAAGGGTTAGAAACATTA
box_v5_AF01c5.0.1.61CAGAGGTCTGACCTGAAAGCGTAAGAATACGTGGCATGGATT
box_v5_AF02c5.0.1.62AAATACGAAACACTCATCTTTTCACGCAAATTAACGTTAGAA
box_v5_AF03c5.0.1.63TCAGAGCGGGAGCTAAACAGGAGGGAAGAAAGCGATAGGCTG
box_v5_AF04c5.0.1.64GCTGACCTTGCCCTGACGAGAGAACTGGCTCATTATCAGTTG
box_v5_AF05c5.0.1.65AGATTTACGTTTACCAGACGACGTCCAATACTGCGGGTCTTT
box_v5_AF06c5.0.1.66ACCCTGAATCGTAACCGTGCAATTAAATGTGAGCGAGTAACA
box_v5_AF07c5.0.1.67ACCCGTCTTTGTTAAAATTCGAATTGCTGAATATATTCATTC
box_v5_AF08c5.0.1.68CATATAACAGTTGATTCCCAAGGGCGCGAGCTGAAAATCACC
box_v5_AF09c5.0.1.69AAATTAAAAGTTACCAGAAGGCTAATATCAGAGAGAACAGGG
box_v5_AF10c5.0.1.70AAGCGCACAGAGCCTAATTTGTCTAAGAACGCGAGAAGAACG
box_v5_AF11c5.0.1.71GTAATAACACCCTCAGAGCCGGCCAGCATTGACAGGAGGTTG
box_v5_AF12c5.0.1.72AGGCAGGTGATACAGGAGTGTATAAATAAGGCGTTTTTCAAA
box_v5_AG01c5.0.1.73TATATTTTAGTTAATTTCATCGTCGCTATTAATTATGATATA
box_v5_AG02c5.0.1.74AGTATAGAGGAGGTTTAGTACCATTCCACAGACAGAGTTTTG
box_v5_AG03c5.0.1.75TCGTCTTAGGCTCCAAAAGGATTGCTTTCGAGGTGAAAGACA
box_v5_AG04c5.0.1.76ATCATACAGGCAAGGCAAAGATTTAAATGCAATGCAAAGGGT
box_v5_AG05c5.0.1.77CCGTGGGGATAGGTCACGTTGTTCAGGCTGCGCAACCTCTTC
box_v5_AG06c5.0.1.78GCTATTACGCCAGCTGGCGAAGACCTTTGATAGCGTTTAGAC
box_v5_AG07c5.0.1.79TATTACATGAATCGGCCAACGGGCGCCAGGGTGGTTTTTCTT
box_v5_AG08c5.0.1.80TTCACCACCGAAATCGGCAAATCAGTGAATAAGGCTTCATCA
box_v5_AG09c5.0.1.81AGAGTAAGACCTGCTCCATGTATACCAAGCGCGAAGACTTTT
box_v5_AG10c5.0.1.82TCATGAGCACCCTCAGCAGCGAATTTCTTAAACAGTGAACCT
box_v5_AG11c5.0.1.82CAAATATTACATTTGAGGATTTAGAAGTATTAGACGCGGAAC
box_v5_AG12c5.0.1.83CCTGTAGCGCCACCCTCAGAAACAGTAACAGTACCTACAAAA
box_v5_AH01c5.0.1.84TCGCGCAGAGGCGAATTATTCTTACCTTTTTTAATTCCTTGA
box_v5_AH02c5.0.1.85AAACATAACGCGAGAAAACTTAAATAAGAATAAACACAGTAG
box_v5_AH03c5.0.1.86GGCTTAACCGACAAAAGGTAATGAACAAGAAAAATAACCAAG
box_v5_AH04c5.0.1.87TACCGCACTCATCGAGAACAAAATCAGATATAGAACTTATTA
box_v5_AH05c5.0.1.88GCGTTTGCAAGGCCGGAAACGTCACCAATGAAACCAAAGGTG
box_v5_AH06c5.0.1.89AATTATCGAGAATAACATAAAATAACCCACAAGAATTGAGTT
box_v5_AH07c5.0.1.90AAGCCCATTAAGAAAAGTAAGCGTAGAAAATACATTATATTT
box_v5_AH08c5.0.1.91CGGAAGCTAAATCAAAAATCAGAATCGTCATAAATAAGCTTG
box_v5_AH09c5.0.1.92CATGCCTGCATAAAGTGTAAAGCCTGGGGTGCCTACGTTGCG
box_v5_AH10c5.0.1.93CTCACTGAACTAATGCAGATACATTGTGAATTACCTTATGCG
box_v5_AH11c5.0.1.94CAACGTCAAAGGGCGAAAAACGTGAACCATCACCCAGGGCGC
box_v5_AH12c5.0.1.95TGGCAAGCCACACCCGCCGTCCGTTGTAGCAATACGCCTGAG
box_v5_BA01c5.0.1.96TAGAAGAAGTCACACGACCAGGAGATAGAACCCTTGAGGCGG
box_v5_BA02c5.0.1.97TCAGTATTAACACC
box_v5_BA03c5.0.1.98ATGGTCATAATGCC
box_v5_BA04c5.0.1.99CGCGTCTGGCCTTCCTGTAGCTTTTAACCAATAGGTCCTTTT
box_v5_BA05c5.0.1.100GATAAGAAGATTTAGTTTGACCATTAGA
box_v5_BA06c5.0.1.101AAGCCCGCATGTTT
box_v5_BA07c5.0.1.102TAATTGCAACGCCA
box_v5_BA08c5.0.1.103CACTCCAGCCAGCTTTCCGGCGGGACGACGACAGTAACGAGA
box_v5_BA09c5.0.1.104ATGACCAAAACTCCAACAGGTCAGGATT
box_v5_BA10c5.0.1.105AGAGGGGCATCAAA
box_v5_BA11c5.0.1.106TTCAGAAATCGGCC
box_v5_BA12c5.0.1.107ACGAGGCCCTCAAA
box_v5_BB01c5.0.1.108TAACGGATTGCAAA
box_v5_BB02c5.0.1.109CTTTAATCATAACG
box_v5_BB03c5.0.1.110CAACGTACTACGTT
box_v5_BB04c5.0.1.111AAGAGGATGAGATG
box_v5_BB05c5.0.1.112TGACGGGGGATATT
box_v5_BB06c5.0.1.113ATAAATTGTGTCGAAATCCGCTCTTGACAAGAACCGAAAGCC
box_v5_BB07c5.0.1.114GGCGAACCGGAACCCTAAAGGGAGCCCC
box_v5_BB08c5.0.1.115AAGAGGCCCGAACT
box_v5_BB09c5.0.1.116AGAAGTGAGATTTG
box_v5_BB10c5.0.1.117ACAGAGGCTTTGAGGACTAAAACAAAGTACAACGGTTTTTAT
box_v5_BB11c5.0.1.118AATCAGTGATTTTAGACAGGAACGGTAC
box_v5_BB12c5.0.1.119TCGGTCGAGGCACC
box_v5_BC01c5.0.1.120GGAAATAAACGAGG
box_v5_BC02c5.0.1.121TATCAGCGCCTTTA
box_v5_BC03c5.0.1.122GCCACGCCCACGCA
box_v5_BC04c5.0.1.123AGAAAGGAACAACTAAAGGAAAACAACTTTCAACATTAAAAG
box_v5_BC05c5.0.1.124GATCTAACCCTCAT
box_v5_BC06c5.0.1.125ATTAATTGTTTCAG
box_v5_BC07c5.0.1.126CAATAGGAACCCATGTACCGTAGCCACCACCCTCAAAGAAAT
box_v5_BC08c5.0.1.127TGCGTAGAGCAAAAGAAGATGATGAAAC
box_v5_BC09c5.0.1.128CGTACTCCCCGGAA
box_v5_BC10c5.0.1.129AGAAATATTTTCAG
box_v5_BC11c5.0.1.130GAGAAGGAGAGGCT
box_v5_BC12c5.0.1.131GAGTAACTTAACGG
box_v5_BD01c5.0.1.132CGCAGTCTTAAAGC
box_v5_BD02c5.0.1.133AGCCGCCCCACCAG
box_v5_BD03c5.0.1.134AGCCACCTCAAAAT
box_v5_BD04c5.0.1.135TAGCGTCCTCCCGA
box_v5_BD05c5.0.1.136GCTGTCTTTCCTTATCATTCCGCGTTTTAGCGAACAGACTGT
box_v5_BD06c5.0.1.137AGCGCGTCGTAATCAGTAGCGACAGAAT
box_v5_BD07c5.0.1.138CAGTAGCTTAGAGC
box_v5_BD08c5.0.1.139GGAGGGATAACTGA
box_v5_BD09c5.0.1.140TTTGAAGCCTTAGCGTCTTTCTTAGACGGGAGAATAGGTAAA
box_v5_BD10c5.0.1.141TATTGACCAAAGACAAAAGGGCGACATT
box_v5_BD11c5.0.1.142AGACACCACATATA
box_v5_BD12c5.0.1.143AAAAGAACAATAAT
box_v5_BE01c5.0.1.144GCTATCTAAACATT
box_v5_BE02c5.0.1.145TTAACGTAAACAAT
box_v5_BE03c5.0.1.146TACCGCGATAAGAA
box_v5_BE04c5.0.1.147CAGAACGTTTTCAT
box_v5_BE05c5.0.1.148GCATTTTAGAAACC
box_v5_BE06c5.0.1.149TATACAAACAACAT
box_v5_BE07c5.0.1.150GTTTGAAACATGTA
box_v5_BE08c5.0.1.151CAAAATCTGTTTAG
box_v5_BE09c5.0.1.152GTAAATCTTCTGAC
box_v5_BE10c5.0.1.153AACAAAAGAGTCAA
box_v5_BE11c5.0.1.154TGATTGCAGTGAAT
box_v5_BE12c5.0.1.155TGGCAATAAACAAT
box_v5_BF01c5.0.1.156ATCAACAATTCCTG
box_v5_BF02c5.0.1.157TAGCCCTATATCTG
box_v5_BF03c5.0.1.158GCCAACATAATAAA
box_v5_BF04c5.0.1.159ATCACTTTTCTTTG
box_v5_BF05c5.0.1.160GTAACCATGTAGCG
box_v5_BF06c5.0.1.161CCACTACCGTCTAT
box_v5_BF07c5.0.1.162GGGTTGAAAAAGAA
box_v5_BF08c5.0.1.163GTCCACGGAGAGAG
box_v5_BF09c5.0.1.164CGTATTGCGCGGGG
box_v5_BF10c5.0.1.165TTAATTGATGAGTG
box_v5_BF11c5.0.1.166TAGTACCGCGACCG
box_v5_BF12c5.0.1.167TGTAAAAGTTTTCC
box_v5_BG01c5.0.1.168GTGCGGGCTGTTGG
box_v5_BG02c5.0.1.169GTAATGGAACAAAC
box_v5_BG03c5.0.1.170TTAAATTAGATTGT
box_v5_BG04c5.0.1.171AGATTCACTGAGTA
box_v5_BG05*****
box_v5_BG06*****
box_v5_BG07*****
box_v5_BG08*****
box_v5_BG09*****
box_v5_BG10*****
box_v5_BG11*****
box_v5_BG12*****
box_v5_BH01*****
box_v5_BH02*****
box_v5_BH03*****
box_v5_BH04*****
box_v5_BH05*****
box_v5_BH06*****
box_v5_BH07*****
box_v5_BH08*****
box_v5_BH09*****
box_v5_BH10*****
box_v5_BH11*****
box_v5_BH12*****
box_v5_CA01c5.0.2.1CCCTGCCAGGGATC
box_v5_CA02c5.0.2.2GCCGCCACCAGAACCACCACCCGGAAGTTGGAAGCATCTGTA
box_v5_CA03c5.0.2.3AGCAACTCCCTGGAGTGACTCCAGTGCCAAGCTTTCGCCAGG
box_v5_CA04c5.0.2.4GTTTTCCTTCCGGCACCGCTTCGACAGTATCGGCCCTGTAGC
box_v5_CA05c5.0.2.5CAGCTTTCAATAGGAACGCCAGTAAAACTAGCATGGAGAGTC
box_v5_CA06c5.0.2.6TGGAGCAAGTAATGTGTAGGTAAATTTTTAGAACCCATTAAC
box_v5_CA07c5.0.2.7ATCCAATCGAGCTGAAAAGGTGTTTTAAATATGCATTAGAGC
box_v5_CA08c5.0.2.8TTAATTGCAAAAAGATTAAGAGGAAGCCCGAAAGACAAAAAT
box_v5_CA09c5.0.2.9CAGGTCTCCAGAGGGGGTAATAGTAAAATGTTTAGAAGAGCA
box_v5_CA10c5.0.2.10ACACTATTCTGGAAGTTTCATCTGTTTAGCTATATTTTCATT
box_v5_CA11c5.0.2.11TGGGGCGAAATCATACAGGCACGATTTTAAGAACTATCAACG
box_v5_CA12c5.0.2.12TAACAAAGCTGCTCATTCAGTGAACGGTGTACAGAGTGAGAA
box_v5_CB01c5.0.2.13AGGCCGGATCTACAAAGGCTATCAGGTCATTGCCTTCAATCA
box_v5_CB02c5.0.2.14TATGTACCTCATCTTTGACCCCTACAGAGGCTTTGAGGACTA
box_v5_CB03c5.0.2.15AAGACTTGCTTGCAGGGAGTTGTGAGCGAGTAACACCGTGCA
box_v5_CB04c5.0.2.16TCTGCCAGTTTGAGGGGACGACTGGTGCCGGAAACAATAATA
box_v5_CB05c5.0.2.17ATTTTTTACGATCTAAAGTTTTGTCGTCTTTCCAGATGTACC
box_v5_CB06c5.0.2.18GTAACACGGGTGGATGTTCTTAACCCCGCTTCTAATCTATTT
box_v5_CB07c5.0.2.19ACGCTCGCGTCGGTGGGCACGTGCTCAGTACCAGGTTGAGTA
box_v5_CB08c5.0.2.20ACAGTGCCCGTATAAACAGTTATTTACCGTTCCAGCATTGAC
box_v5_CB09c5.0.2.21AGGAGGTTGAGGCAGGTCAGAAACAGGGCTTAAGCGAATCGG
box_v5_CB10c5.0.2.22CTGACGCTGTCCCGCCAAAATCTAAGTGGTTGTGATGGCGAA
box_v5_CB11c5.0.2.23AGGGGGATTCGCCATTCAGGCTGGGCGCATCGTAAACCCGTC
box_v5_CB12c5.0.2.24GGATTCTAAATTCGCATTAAAAGAAAAGCCCCAAAGCTATTT
box_v5_CC01c5.0.2.25TTGAGAGAGACAGTCAAATCAAATACTTTTGCGGGCAAAATT
box_v5_CC02c5.0.2.26AAGCAATAAATGGTCAATAACTCCATATAACAGTTTTTAATT
box_v5_CC03c5.0.2.27GCTCCTTTTTTAATTCGAGCTTCAAAGCGAACCAGCAAATGC
box_v5_CC04c5.0.2.28TTTAAACAATACTGCGGAATCGTCATAA
box_v5_CC05c5.0.2.29TCCTGGTTGGTGTAATGAGTACGATTGGCCTTGATAAGCCAG
box_v5_CC06c5.0.2.30AATGGAAAGCGCAGTCTCTGAAATGCCCCCTGCCTAAGAGAA
box_v5_CC07c5.0.2.31GGATTAGCCCTCAGAACCGCCCCCAATAGGAACCCACGTTAG
box_v5_CC08c5.0.2.32TAAATGAATAGAAAGGAACAACTTAAACAGCTTGAATTCGGT
box_v5_CC09c5.0.2.33CGCTGAGTTTCATGAGGAAGTGAAAGAGGCAAAAGGCTCCAT
box_v5_CC10c5.0.2.34GTTACTTGAAAGAGGACAGATGAATAAGGCTTGCCAACTTTA
box_v5_CC11c5.0.2.35ATCATTGAAAGATTCATCAGTTTACGAGGCATAGTACTGGAT
box_v5_CC12c5.0.2.36AGCGTCCAGTTCAGAAAACGAGAATGACCATAAATCTTCAAA
box_v5_CD01c5.0.2.37TATCGCGTTGATAAGAGGTCATTTTTGCGGATGGCACTAAAG
box_v5_CD02c5.0.2.38TACGGTGCATAACCCTCGTTTACTAACGGAACAACATTATTA
box_v5_CD03c5.0.2.39CAGGTAGTGAATTACCTTATGAGGCAAAGAATTAGAGAAGCC
box_v5_CD04c5.0.2.40TTTATTTCAACGCAAGGATAAAAAGATTCAAAAGGCCAGGCG
box_v5_CD05c5.0.2.41CATAGGCTGATAAATTGTGTCGAAATCCGCGACCTAATACAC
box_v5_CD06c5.0.2.42TAAAACACCCGGTTGATAATCTTTTTGTTAAATCAGCTCATT
box_v5_CD07c5.0.2.43TTTTAACCATCAACATTAAATAAAGGCCGCTTTTGTTTATCA
box_v5_CD08c5.0.2.44GCTTGCTTTCGAGGTGAATTTCTAAAGGAATTGCGCAGGCAA
box_v5_CD09c5.0.2.45AGCGCCATGTGCTGCAAGGCGATTAAGTTGGGTAACTCAGGA
box_v5_CD10c5.0.2.46GAAGCCATGAGTTTCGTCACCACCGTACTCAGGAGGTTTAGT
box_v5_CD11c5.0.2.47ACCGCCAGATTAGCGGGGTTTAATATAGGGGCCTTTACGTGG
box_v5_CD12c5.0.2.48TGCTTGTTACCTCGATAAAGAAGAGCCGCCGCCAGTAAGCGT
box_v5_CE01c5.0.2.49CATACATGGCTTTTGATGATAACGGGGTCAGTGCCCGGATAA
box_v5_CE02c5.0.2.50GTGCCGTGGAATAGGTGTATCAGTACAAACTACAATCATAGT
box_v5_CE03c5.0.2.51TAGCGTACACGTTGAAAATCTTTTAATTGTATCGGCGGGATC
box_v5_CE04c5.0.2.52GTCACCCGAGGGTAGCAACGGCCAGCGATTATACCTTTGTAT
box_v5_CE05c5.0.2.53CATCGCCTGGCTGACCTTCATTATTCATTACCCAAGGCTCAT
box_v5_CE06c5.0.2.54TATACCACGTTAATAAAACGAACCAGACGACGATACAAAAGA
box_v5_CE07c5.0.2.55AGTTTTGTTACCCTGACTATTATAGTCA
box_v5_CE08c5.0.2.56GAATTGTCAACCTTATGACAAATTTCACATAAATCGGCTGAG
box_v5_CE09c5.0.2.57ACTCCTCATTTCGGAACCTATTATTCTG
box_v5_CE10c5.0.2.58ATTAAGAATTTCTC
box_v5_CE11c5.0.2.59CGACGGCTATGATA
box_v5_CE12c5.0.2.60CCTCTTCGCTATTACGCCAGCATTCATGCGCACGATCAGGGA
box_v5_CF01c5.0.2.61TAGCAAGACCCTCAGAACCGCCACCCTC
box_v5_CF02c5.0.2.62CTCATTTCTTAAGT
box_v5_CF03c5.0.2.63GCCAGCTCAGTCAC
box_v5_CF04c5.0.2.64GATAGGTCACGTTGGTGTAGATGCGCAACTGTTGGTCAGCGG
box_v5_CF05c5.0.2.65AGTGAGAATTTTCTGTATGGGATTTTGC
box_v5_CF06c5.0.2.66AACAGTTGAAGGGC
box_v5_CF07c5.0.2.67GGCCTTCTCAGGAA
box_v5_CF08c5.0.2.68GTAAACGTTAATATTTTGTTACCGTGGGAACAAACCGCATAA
box_v5_CF09c5.0.2.69CCGATATTACCGATAGTTGCGCCGACAA
box_v5_CF10c5.0.2.70TCGCCCAGGCGGAT
box_v5_CF11c5.0.2.71GGTAATCTCAAAAA
box_v5_CF12c5.0.2.72AAATTAATGCCGGAGAGGGTAAACAGGAAGATTGTCACCAAC
box_v5_CG01c5.0.2.73CTAAAACTTCCATTAAACGGGTAAAATA
box_v5_CG02c5.0.2.74ACGAAGGATAAGCA
box_v5_CG03c5.0.2.75ATGCCTGAACAAGA
box_v5_CG04c5.0.2.76CCAAAAACATTATGACCCTGTCCATCAATATGATAAACTGAC
box_v5_CG05c5.0.2.77CAACTTTAGCCGGAACGAGGCGCAGACG
box_v5_CG06c5.0.2.78GGAACCGTTCAACC
box_v5_CG07c5.0.2.79GTAGTAGCTCATAT
box_v5_CG08c5.0.2.80TGACCATTAGATACATTTCGCAAAGCCTCAGAGCAGATGGTT
box_v5_CG09c5.0.2.81TAATTTCCTGACGAGAAACACCAGAACG
box_v5_CG10c5.0.2.82GGCTTGATAAAGCT
box_v5_CG11c5.0.2.83TCAACATGGCATCA
box_v5_CG12c5.0.2.84AGGTCAGGATTAGAGAGTACCGATTCCCAATTCTGAACGCCA
box_v5_CH01c5.0.2.85AAAGGAATGAGATTTAGGAATACCACAT
box_v5_CH02c5.0.2.86GATACATCGAACGA
box_v5_CH03c5.0.2.87ATTGCATCTGAATA
box_v5_CH04c5.0.2.88TCCCCCTACCGGAA
box_v5_CH05c5.0.2.89GCTTTTGAAAACCA
box_v5_CH06c5.0.2.90AAATCTAGTCAGGA
box_v5_CH07c5.0.2.91AACCGGACAAGAGT
box_v5_CH08c5.0.2.92ACGGAGAAAGCGCG
box_v5_CH09c5.0.2.93TCGGAACTCAGCAG
box_v5_CH10c5.0.2.94AGGAGCCCCAAAAA
box_v5_CH11c5.0.2.95ACAGCCCCGCCTGT
box_v5_CH12c5.0.2.96ATAGCCCCGAGAGG
box_v5_DA01c5.0.2.97AGTTTTACAGGAGT
box_v5_DA02c5.0.2.98CTCATTAATTCACA
box_v5_DA03c5.0.3.1CATTAAAGTAGCGC
box_v5_DA04c5.0.3.2CGTTGCGCTCACTGCCCGCTTTTTAGCGTCAGACTGGTGAAT
box_v5_DA05c5.0.3.3TATCACCAGGGAGGGAAGGTAATGTTAGCAAACGTCCAAAAG
box_v5_DA06c5.0.3.4AACTGGCACCCACAAGAATTGCAAAGTCAGAGGGTGTTACAA
box_v5_DA07c5.0.3.5AATAAACACCAACGCTAACGACCAATAGCAAGCAACAAGCCG
box_v5_DA08c5.0.3.6TTTTTATGCCTGTTTATCAACACGACGACAATAAATTCTTAC
box_v5_DA09c5.0.3.7CAGTATAACTAGAAAAAGCCTGATGCAAATCCAATCTCCGGC
box_v5_DA10c5.0.3.8TTAGGTTGTGAGTGAATAACCTTGCTTCTGTAAATACAATTT
box_v5_DA11c5.0.3.9CATTTGAGATTCGCCTGATTGCTTTGAATACCAAGAAAGAAA
box_v5_DA12c5.0.3.10TTGCGTACGCGAGAAAACTTTAATAAGAATAAACACCGGAAT
box_v5_DB01c5.0.3.11CATAATTAAGCCAACGCTCAATAACATTATCATTTACTAATA
box_v5_DB02c5.0.3.12GATTAGAGCCGTCAATAGATAAATCAATATCTGGTGAACAAG
box_v5_DB03c5.0.3.13AAAAATAACCAAGTACCGCACTCATCGAGAACAAGATCAGAT
box_v5_DB04c5.0.3.14ATAGAAGCGCGAACTGATAGCTCACCAGTCACACGACCAGTA
box_v5_DB05c5.0.3.15ATAAAAGCATTGCAACAGGAATCCCAATCCAAATAGACGGGA
box_v5_DB06c5.0.3.16GAATTAACTGAACACCCTGAAAGTTAAGCCCAATACAGAATC
box_v5_DB07c5.0.3.17CTGAGAACGCCGCTACAGGGCGCGTACTATGGTTGAAAGCGA
box_v5_DB08c5.0.3.18AAGGAGCTAAAGGTGGCAACAAGACAAAAGGGCGACATTCAA
box_v5_DB09c5.0.3.19CCGATTGGTCACCGACTTGAGCAACGTCAAAGGGCAAATCCT
box_v5_DB10c5.0.3.20GTTTGATGGTGGTTCCGAAATGGGCAACAGCTGATCTGTCGT
box_v5_DB11c5.0.3.21GCCAGCTGCATTAATGAATCGGATAGCAGCACCGTGAGCCAG
box_v5_DB12c5.0.3.22CAAAATCTTTACCAGCGCCAATATAAAAGAAACGCTTACCAG
box_v5_DC01c5.0.3.23AAGGAAACAATGAAATAGCAAAGGGAAGCGCATTAAGAAACG
box_v5_DC02c5.0.3.24ATTTTTTAGTTGCTATTTTGCCTAAGAACGCGAGGAGAACGG
box_v5_DC03c5.0.3.25GTATTAAATATCCCATCCTAAAGAATATAAAGTACTGAGAAT
box_v5_DC04c5.0.3.26CGCCATATAAATAAGGCGTTATTCAAATATATTTTGAATTTA
box_v5_DC05c5.0.3.27TCAAAATAATTTTCCCTTAGAATCCTTGAAAACATATGATGA
box_v5_DC06c5.0.3.28AACAAACAGAGGCGAATTATTCATTTCA
box_v5_DC07c5.0.3.29AACGTCACCAATGAAACCATCGCCAACGCGCGGGGGGGTGGT
box_v5_DC08c5.0.3.30TTTTCTTTTCACCAGTGAGACCGGCAAAATCCCTTAGAGTCC
box_v5_DC09c5.0.3.31ACTATTAACTAAATCGGAACCGAAAGGAAGGGAAGCTTTGAC
box_v5_DC10c5.0.3.32GAGCACGAAAGGGATTTTAGATAGTAATAACATCAATATTAC
box_v5_DC11c5.0.3.33CGCCAGCGGACATTCTGGCCAATTTTTGAATGGCTCTGCAAC
box_v5_DC12c5.0.3.34AGTGCCAAATATCAAACCCTCATACATTTGAGGATCGAACGT
box_v5_DD01c5.0.3.35TATTAATCCTGATTGTTTGGACGTAAAACAGAAATTTACAAA
box_v5_DD02c5.0.3.36ATCGCGCATCAAGAAAACAAAATTAATTACATTTACGTCGCT
box_v5_DD03c5.0.3.37ATTAATTCATAGGTCTGAGAGACTACCTTTTTAACCGCAAGA
box_v5_DD04c5.0.3.38CAAAGAAGATTTTCAGGTTTATCAGATGATGGCAATTCATCA
box_v5_DD05c5.0.3.39ATATAATTTTAAAAGTTTGAGCAGTAGGGCTTAATCGACAAA
box_v5_DD06c5.0.3.40AGGTAAAGTAATTCTGTCCAGAATAGATAAGTCCTCAGTTGG
box_v5_DD07c5.0.3.41CAAATCAGAGGTGAGGCGGTCAGTATTAACACCGCATTAGTC
box_v5_DD08c5.0.3.42TTTAATGGCTTATCCGGTATTACCCAGCTACAATTTTATCCT
box_v5_DD09c5.0.3.43GAATCTTAGCCATATTATTTAAAACGCTCATGGAATTAACCG
box_v5_DD10c5.0.3.44TTGTAGCAATACTTCTTTGATCAGGAACGGTACGCATAAGAG
box_v5_DD11c5.0.3.45CAAGAAACCGAGGAAACGCAATAATAACGGAATACAGAAAAT
box_v5_DD12c5.0.3.46ACATACAGGGCGCTAGGGCGCGTTTTTTGGGGTCGAGGTGCC
box_v5_DE01c5.0.3.47GTAAAGCAAGAACGTGGACTCCCATTTGGGAATTAAATCAGT
box_v5_DE02c5.0.3.48AGCGACAGAATCAAGTTTGCCTCCAGTCGGGAAACTGCCCTT
box_v5_DE03c5.0.3.49CACCGCCTGGCCCTGAGAGAGGCCCCAGCAGGCGAGAAAAAC
box_v5_DE04c5.0.3.50CGTCTATATCACCCAAATCAATGGCAAGTGTAGCGCGCCGCG
box_v5_DE05c5.0.3.51CTTAATGGTGTTTTTATAATCGTCCATCACGCAAAATACCTA
box_v5_DE06c5.0.3.52CATTTTGTTACATTGGCAGATCCTAAAACATCGCCCAGAAGA
box_v5_DE07c5.0.3.53TAAAACAACAGTTGAAAGGAATAGGAGCACTAACATGCGGAA
box_v5_DE08c5.0.3.54CAAAGAACATATTCCTGATTAACGTCAGATGAATAGAGAAAC
box_v5_DE09c5.0.3.55AATAACGATTACCTTTTTTAATGGAAAC
box_v5_DE10c5.0.3.56ATCAATAGAAAATTCATATGGACCAGTAGCACCATTCCAGTT
box_v5_DE11c5.0.3.57TGGAACAATAAATCAAAAGAATAGCCCG
box_v5_DE12c5.0.3.58GTGTTGTTACCATT
box_v5_DF01c5.0.3.59ACGCAGTAATATTG
box_v5_DF02c5.0.3.60TAAGCAGATAGCCGAACAAAGAAAGACACCACGGAGGCGAAC
box_v5_DF03c5.0.3.61GTGGCGACTAAAGGGAGCCCCCGATTTA
box_v5_DF04c5.0.3.62GAAAGCCATAAGTT
box_v5_DF05c5.0.3.63AGAGATAATGATTA
box_v5_DF06c5.0.3.64CAGAGAGAATAACATAAAAACTAGCTATCTTACCGACAGGAG
box_v5_DF07c5.0.3.65GCCGATTTATAACGTGCTTTCCTCGTTA
box_v5_DF08c5.0.3.66GAGCTAAAAGCCCT
box_v5_DF09c5.0.3.67TTTGCCAAATTGAG
box_v5_DF10c5.0.3.68TTGAAGCCTTAAATCAAGATTGTTTAACGTCAAAATAATATC
box_v5_DF11c5.0.3.69CAGAACACTTGCCTGAGTAGAAGAACTC
box_v5_DF12c5.0.3.70TTGCTGGATGAAAA
box_v5_DG01c5.0.3.71ACCGCGCGCGTCTT
box_v5_DG02c5.0.3.72CTGTCTTTCCTTATCATTCCACGTTTTAGCGAACCGTGGCAC
box_v5_DG03c5.0.3.73AGACAATACAGAGATAGAACCCTTCTGA
box_v5_DG04c5.0.3.74AGAATACTCCCGAC
box_v5_DG05c5.0.3.75AGAACGCTTTCATC
box_v5_DG06c5.0.3.76CATTTTCGAGCCAGTAATAAGTTTACGAGCATGTACTTGCTG
box_v5_DG07c5.0.3.77AACCTCACGCTGAGAGCCAGCAGCAAAT
box_v5_DG08c5.0.3.78GCATCACGAAACCA
box_v5_DG09c5.0.3.79ATACAAACAACATG
box_v5_DG10c5.0.3.80TTTGAAATACCGACCGTGTGATTTAACAACGCCAATTAAATC
box_v5_DG11c5.0.3.81CTTTGCCTTAGAAGTATTAGACTTTACA
box_v5_DG12c5.0.3.82ACTCGTACATGTAA
box_v5_DH01c5.0.3.83AAATGCTGTTTAGT
box_v5_DH02c5.0.3.84ACGCTGAGAAGAGTCAATAGTAGTTAATTTCATCTCAAAATT
box_v5_DH03c5.0.3.85ATTTGCATTATACTTCTGAATAATGGAA
box_v5_DH04c5.0.3.86ACCATATTCTGACC
box_v5_DH05c5.0.3.87AATATATGGGTTAT
box_v5_DH06c5.0.3.88AAAGAAGAGCGATA
box_v5_DH07c5.0.3.89ACATCGGTACAGTA
box_v5_DH08c5.0.3.90TTATCATACCACCA
box_v5_DH09c5.0.3.91ATATCTTTTGAGGA
box_v5_DH10c5.0.3.92CCACCAGATTAAAA
box_v5_DH11c5.0.3.93GGATTATACGCTCA
box_v5_DH12c5.0.3.94AGAGTCTAGTGAGG
box_v5_EA01c5.0.3.95CCACACCGTCACGC
box_v5_EA02c5.0.3.96GTGAACCCAGGGCG
box_v5_EA03c5.0.3.97CTGGTTTTTGCAGC
box_v5_EA04c5.0.3.98GGCGCCAAGAGGCG
box_v5_EA05c5.0.4.1ATAAATCGTGTTGTTCCAGTTTGGAACAAGAGTCCGTAAAGC
box_v5_EA06c5.0.4.2GCCGGAAGCAGGTCGACTCTAAGGGGGATGTGCTGCGGAAAC
box_v5_EA07c5.0.4.3TCATTTTTTTACAAACAATTCAAATGAAAAATCTAGATAAAA
box_v5_EA08c5.0.4.4ATCAATAGATAAAAATTTTTAGAACCCTCATATATATTAGCA
box_v5_EA09c5.0.4.5GGTATTAAATATCCCATCCTAATTTACGAGCATGTCGAGCCA
box_v5_EA10c5.0.5.1GCCGCCATTGATATTCACAAACAAATAAATCCTCATCTGAAT
box_v5_EA11c5.0.5.2ATTTACATTTTGCGGGATCGTGAAGTTTCCATTAAACGGGTA
box_v5_EA12c5.0.5.3TGGATAGCGATAAAAACCAAAATAGCGAGAGGCTTACAACAT
box_v5_EB01c5.0.5.4AAAGAAAAATGAATTTTCTGTTCACCAGTACAAACTACAACG
box_v5_EB02c5.0.5.5TCATTTGTTCTGCGAACGAGTGGTCATTTTTGCGGACCAGAC
box_v5_EB03c5.0.6.1CCGCCTCGACGACGACAATAAATTCTTACCAGTATAAAGCCA
box_v5_EB04c5.0.6.2GCATCGGCCTACATTTTGACGACCGCCAGCCATTGCAACAGG
box_v5_EB05c5.0.6.3GAGAAAGCCCCAAAAACAGGAGTAAACGTTAATATGGATTCT
box_v5_EB06c5.0.7.1GCCCTTTATAATAAGAGCAAGCAAAAATGAAAATATTATCCC
box_v5_EB07c5.0.7.2ATTTTAAAACACCAGAACGAGCAGGCGAAAATCCTTGGACTC
box_v5_EB08c5.0.7.3TTTGAGTACCTACCATATCAAAATTATT
box_v5_EB09*****
box_v5_EB10*****
box_v5_EB11*****
box_v5_EB12*****
box_v5_EC01*****
box_v5_EC02*****
box_v5_EC03*****
box_v5_EC04*****
box_v5_EC05*****
box_v5_EC06*****
box_v5_EC07*****
box_v5_EC08*****
box_v5_EC09*****
box_v5_EC10*****
box_v5_EC11*****
box_v5_EC12*****
box_v5_ED01*****
box_v5_ED02*****
box_v5_ED03*****
box_v5_ED04*****
box_v5_ED05*****
box_v5_ED06*****
box_v5_ED07*****
box_v5_ED08*****
box_v5_ED09*****
box_v5_ED10*****
box_v5_ED11*****
box_v5_ED12*****
box_v5_EE01*****
box_v5_EE02*****
box_v5_EE03*****
box_v5_EE04*****
box_v5_EE05*****
box_v5_EE06*****
box_v5_EE07*****
box_v5_EE08*****
box_v5_EE09*****
box_v5_EE10*****
box_v5_EE11*****
box_v5_EE12*****
box_v5_EF01*****
box_v5_EF02*****
box_v5_EF03*****
box_v5_EF04*****
box_v5_EF05*****
box_v5_EF06*****
box_v5_EF07*****
box_v5_EF08*****
box_v5_EF09*****
box_v5_EF10*****
box_v5_EF11*****
box_v5_EF12*****
box_v5_EG01*****
box_v5_EG02*****
box_v5_EG03*****
box_v5_EG04*****
box_v5_EG05*****
box_v5_EG06*****
box_v5_EG07*****
box_v5_EG08*****
box_v5_EG09*****
box_v5_EG10*****
box_v5_EG11*****
box_v5_EG12*****
box_v5_EH01*****
box_v5_EH02*****
box_v5_EH03*****
box_v5_EH04*****
box_v5_EH05*****
box_v5_EH06*****
box_v5_EH07*****
box_v5_EH08*****
box_v5_EH09*****
box_v5_EH10*****
box_v5_EH11*****
box_v5_EH12*****
Personal tools