Eccles:QPCR reference genes

From OpenWetWare

Jump to: navigation, search

Eccles Lab > DGG Oligos > QPCR > reference genes (Sybr)

A red heading indicates candidate reference gene primers that have not been ordered.

Contents

Human

ACTB: actin, beta

  • RTPrimerDB ID: 2219
  • Organism: Homo sapiens (Hs, Human)
  • Forward Primer: TCCCTGGAGAAGAGCTACG (19 bp) exon 3
    • DGG ID: 2769
    • DGG name: Hs_ACTB_F
    • Current [stock]: 64.4 uM
  • Reverse Primer: GTAGTTTCGTGGATGCCACA (20 bp) exon 4
    • DGG ID: 2770
    • DGG name: Hs_ACTB_R
    • Current [stock]: 91.6 uM
  • Annealing Temperature: 60 °C
  • 131 bp
  • Genomic amplicon: 226bp

B2M

GAPDH

  • RTPrimerDB ID: 3
  • GAPD: glyceraldehyde-3-phosphate dehydrogenase
  • Alias Symbol(s): G3PD, GAPDH, 3' end
  • Organism: Homo sapiens (Hs, Human)
  • Entrez Gene ID: 2597
  • Ensembl Gene ID: ENSG00000111640
  • This primer pair amplifies part of the following transcript:
    • ENST00000229239 (Exons: 9, Transcript length: 1310 bp, Translation length: 335 residues)(length: 87 bp)
  • Forward Primer: TGCACCACCAACTGCTTAGC (20 bp) exon 7
    • DGG ID:
    • DGG name: Hs_GAPDH_F
    • Current [stock]: 131 uM
  • Reverse Primer: GGCATGGACTGTGGTCATGAG (21 bp) exon 7/8
    • DGG ID:
    • DGG name: Hs_GAPDH_R
    • Current [stock]: 113 uM
  • Annealing Temperature: 60 °C
  • Publication PubMed ID 12184808, Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F

Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes

Genome Biol. 2002 Jun 18;3(7):RESEARCH0034. Epub 2002 Jun 18

GNB2L1

  • F: CACAACGGGCACCACCAC
    • Current [stock]: 142 uM
  • R: CACACACCCAGGGTATTCCAT
    • Current [stock]: 103 uM

HMBS: hydroxymethylbilane synthase

  • RTPrimerDB ID: 4
  • Alias Symbol(s): AIP, UPS, PBGD
  • Organism: Homo sapiens (Hs, Human)
  • This primer pair amplifies part of the following transcript:
    • ENST00000278715 (Exons: 14, Transcript length: 1501 bp, Translation length: 361 residues)(length: 64 bp)
  • Genomic amplicon: 3252bp
  • Forward Primer: GGCAATGCGGCTGCAA (16 bp) Exon 1
    • DGG ID: 2777
    • DGG name: Hs_HMBS_F
    • Current [stock]: 100.3 uM
  • Reverse Primer: GGGTACCCACGCGAATCAC (19 bp) Exon 2
    • DGG ID: 2778
    • DGG name: Hs_HMBS_R
    • Current [stock]: 49.9 uM
  • Annealing Temperature: 60 °C

HPRT1: hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)

  • RTPrimerDB ID: 5
  • Alias Symbol(s): HPRT, HGPRT
  • Organism: Homo sapiens (Hs, Human)
  • (length: 94 bp)
  • Genomic Amplicon: 4893bp
  • Forward Primer: TGACACTGGCAAAACAATGCA (21 bp) Exon 6
    • DGG ID: 2771
    • DGG name: Hs_HPRT1_F
    • Current [stock]: 81.7 uM
  • Reverse Primer: GGTCCTTTTCACCAGCAAGCT (21 bp) Exon 6/7
    • DGG ID: 2772
    • DGG name: Hs_HPRT1_R
    • Current [stock]: 80.3 uM
  • Annealing Temperature: 60 °C

PPIB

  • F: ATGATCCAGGGCGGAGACTT
    • Current [stock]: 92 uM
  • R: CAGGCCCGTAGTGCTTCAG
    • Current [stock]: 88 uM

RPL13A: ribosomal protein L13a

  • RTPrimerDB ID: 6
  • Organism: Homo sapiens (Hs, Human)
  • This primer pair amplifies part of the following transcript:
    • ENST00000270634 (Exons: 8, Transcript length: 1125 bp, Translation length: 203 residues)(length: 126 bp)
  • Forward Primer: CCTGGAGGAGAAGAGGAAAGAGA (23 bp)
    • DGG ID: 2779
    • DGG name: Hs_RPL13A_F
    • Current [stock]: 61.9 uM
  • Reverse Primer: TTGAGGACCTCTGTGTATTTGTCAA (25 bp)
    • DGG ID: 2780
    • DGG name: Hs_RPL13A_R
    • Current [stock]: 52.8 uM
  • Annealing Temperature: 60 °C

SDHA: succinate dehydrogenase complex, subunit A, flavoprotein (Fp)

  • RTPrimerDB ID: 7
  • Alias Symbol(s): FP, SDH2, SDHF
  • Organism: Homo sapiens (Hs, Human)
  • This primer pair amplifies part of the following transcripts:
    • ENST00000264932 (Exons: 15, Transcript length: 2280 bp, Translation length: 664 residues)(length: 86 bp)
    • ENST00000327872 (Exons: 13, Transcript length: 1880 bp, Translation length: 517 residues)(length: 86 bp)
  • Forward Primer: TGGGAACAAGAGGGCATCTG (20 bp)
    • DGG ID: 2781
    • DGG name: Hs_SDHA_F
    • Current [stock]: 83.9 uM
  • Reverse Primer: CCACCACTGCATCAAATTCATG (22 bp)
    • DGG ID: 2782
    • DGG name: Hs_SDHA_R
    • Current [stock]: 83 uM
  • Annealing Temperature: 60 °C

TBP: TATA box binding protein

  • RTPrimerDB ID: 2627
  • Alias Symbol(s): GTF2D, SCA17, TFIID, GTF2D1
  • Organism: Homo sapiens (Hs, Human)
  • This primer pair amplifies part of the following transcript:
    • ENST00000230354 (Exons: 8, Transcript length: 1845 bp, Translation length: 339 residues)(length: 132 bp)
  • Forward Primer: TGCACAGGAGCCAAGAGTGAA (21 bp)
    • DGG ID: 2783
    • DGG name: Hs_TBP_F
    • Current [stock]: 77.9 uM
  • Reverse Primer: CACATCACAGCTCCCCACCA (20 bp)
    • DGG ID: 2784
    • DGG name: Hs_TBP_R
    • Current [stock]: 73.6 uM
  • Annealing Temperature: 60 °C

UBC: ubiquitin C

  • RTPrimerDB ID: 8
  • Alias Symbol(s): HMG20
  • Organism: Homo sapiens (Hs, Human)
  • (length: 133 bp)
  • Forward Primer: ATTTGGGTCGCGGTTCTTG (19 bp)
    • DGG ID: 2773
    • DGG name: Hs_UBC_F
    • Current [stock]: 65.9 uM
  • Reverse Primer: TGCCTTGACATTCTCGATGGT (21 bp)
    • DGG ID: 2774
    • DGG name: Hs_UBC_R
    • Current [stock]: 60.5 uM
  • Annealing Temperature: 60 °C

YWHAZ: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

  • RTPrimerDB ID: 9
  • Alias Symbol(s): KCIP-1
  • Organism: Homo sapiens (Hs, Human)
  • (length: 94 bp)
  • Forward Primer: ACTTTTGGTACATTGTGGCTTCAA (24 bp)
    • DGG ID: 2775
    • DGG name: Hs_YWHAZ_F
    • Current [stock]: 47.1 uM
  • Reverse Primer: CCGCCAGGACAAACCAGTAT (20 bp)
    • DGG ID: 2776
    • DGG name: Hs_YWHAZ_R
    • Current [stock]: 85.4 uM
  • Annealing Temperature: 60 °C
  • Not intron-spanning

28S

Mouse

Mouse reference genes for Sybr Green QPCR

Hprt1

  • PrimerBank ID 7305155a1, 142 bp, 7752 bp genomic amplicon
  • GenBank Accession NM_013556
  • NCBI Protein Accession NP_038584
  • Species Mouse
  • Coding DNA Length 657
  • Gene Description hypoxanthine guanine phosphoribosyl transferase [Mus musculus].
  • Primer Pair Descriptions:
  • PrimerBank ID 7305155a1
  • Amplicon Size 142
  • Genomic size 7752

Sequence (5' -> 3') Length Tm Location

  • Forward Primer TCAGTCAACGGGGGACATAAA 21 60.8 324-344 Exon 4
    • DGG ID: 2661
    • DGG name: AJ_Mm_Hprt1F
    • Current [stock]:
  • Reverse Primer GGGGCTGTACTGCTTAACCAG 21 62.4 465-445 Exon 6
    • DGG ID: 2662
    • DGG name: AJ_Mm_Hprt1R
    • Current [stock]:

Actb

  • rtprimerdb ID 2848
  • Amplicon size: 87
  • Genomic size: 174
  • Forward Primer: ATGCTCCCCGGGCTGTAT (18 bp) Exon 2
    • DGG ID: 2663
    • DGG name: AJ_Mm_ActbF
    • Current [stock]:
  • Reverse Primer: CATAGGAGTCCTTCTGACCCATTC (24 bp) Exon 3
    • DGG ID: 2664
    • DGG name: AJ_Mm_ActbR
    • Current [stock]:
  • Annealing Temperature: 60 ??C

B2m

  • rtprimerdb ID 2866
  • Amplicon size: 194 bp
  • Genomic size: 1663
  • Forward Primer: ATTCACCCCCACTGAGACTG (20 bp) Exon 2
    • DGG ID: 2665
    • DGG name: AJ_Mm_B2mF
    • Current [stock]:
  • Reverse Primer: TGCTATTTCTTTCTGCGTGC (20 bp) Exon 4 (UTR)
    • DGG ID: 2666
    • DGG name: AJ_Mm_B2mR
    • Current [stock]:
  • Annealing Temperature: 60 ??C

B2m

  • PrimerBank
  • GenBank Accession NM_009735
  • NCBI Protein Accession NP_033865
  • Species Mouse
  • Coding DNA Length 360
  • Gene Description beta-2 microglobulin; beta 2 microglobulin; beta2-microglobulin [Mus musculus].
  • Primer Pair Descriptions:
  • PrimerBank ID 31981890a1
  • Amplicon Size 104
  • Genomic Size 3172

Sequence (5' -> 3') Length Tm Location

  • Forward Primer TTCTGGTGCTTGTCTCACTGA 21 61.0 26-46 Exon 1
  • Reverse Primer CAGTATGTTCGGCTTCCCATTC 22 61.0 129-108 Exon 2

Gapd

28S

Tbp

  • rtprimerdb ID 49
  • Forward Primer: GGCCTCTCAGAAGCATCACTA (21 bp) Spans Exon2/3
    • DGG ID: 2667
    • DGG name: AJ_Mm_TbpF
    • Current [stock]:
  • Reverse Primer: GCCAAGCCCTGAGCATAA (18 bp) Exon 3
    • DGG ID: 2668
    • DGG name: AJ_Mm_TbpR
    • Current [stock]:
  • Amplicon size: 167
  • Annealing Temperature: 55 ??C

Rpl32

  • PrimerBank
  • GenBank Accession NM_172086
  • NCBI Protein Accession NP_742083
  • Species Mouse
  • Coding DNA Length 408
  • Gene Description ribosomal protein L32 [Mus musculus].
  • PrimerBank ID 25742730a1
  • Amplicon Size 100
  • Genomic size 734

Sequence (5' -> 3') Length Tm Location

  • Forward Primer TTAAGCGAAACTGGCGGAAAC 21 61.4 92-112 Spans exon 2/exon 3
    • DGG ID: 2669
    • DGG name: AJ_Mm_Rpl32F
    • Current [stock]:
  • Reverse Primer TTGTTGCTCCCATAACCGATG 21 60.4 191-171 Exon 3
    • DGG ID: 2670
    • DGG name: AJ_Mm_Rpl32R
    • Current [stock]:

Sdha

  • Primerbank
  • LocusLink ID 66945
  • GenBank Accession BC011301
  • NCBI Protein Accession AAH11301
  • Species Mouse
  • Coding DNA Length 1987
  • Gene Description Sdha protein [Mus musculus].
  • PrimerBank ID 15030102a1
  • Amplicon Size 106
  • Genomic size 1458

Sequence (5' -> 3') Length Tm Location

  • Forward Primer GGAACACTCCAAAAACAGACCT 22 60.4 62-83 Exon 2
    • DGG ID: 2671
    • DGG name: AJ_Mm_SdhaF
    • Current [stock]:
  • Reverse Primer CCACCACTGGGTATTGAGTAGAA 23 61.1 167-145 Exon 3
    • DGG ID: 2672
    • DGG name: AJ_Mm_SdhaR
    • Current [stock]:

Ywhaz

  • PrimerBank
  • GenBank Accession NM_011740
  • NCBI Protein Accession NP_035870
  • Species Mouse
  • Coding DNA Length 738
  • Gene Description tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide [Mus musculus].
  • Primer Pair Descriptions:
  • PrimerBank ID 6756041a3
  • Amplicon Size 120

Sequence (5' -> 3') Length Tm Location

  • Forward Primer AACAGCTTTCGATGAAGCCAT 21 60.3 579-599 Spans exon 5/6
    • DGG ID: 2673
    • DGG name: AJ_Mm_YwhazF
    • Current [stock]:
  • Reverse Primer TGGGTATCCGATGTCCACAAT 21 60.7 698-678 Exon 6/7
    • DGG ID: 2674
    • DGG name: AJ_Mm_YwhazR
    • Current [stock]:

Hmbs

  • PrimerBank
  • GenBank Accession NM_013551
  • NCBI Protein Accession NP_038579
  • Species Mouse
  • Coding DNA Length 1086
  • Gene Description hydroxymethylbilane synthase; porphobilinogen deaminase [Mus musculus].
  • Primer Pair Descriptions:
  • PrimerBank ID 30794512a2
  • Amplicon Size 101
  • Genomic size 285

Sequence (5' -> 3') Length Tm Location

  • Forward Primer ACTCTGCTTCGCTGCATTG 19 60.8 727-745 Exon 11
    • DGG ID: 2675
    • DGG name: AJ_Mm_HmbsF
    • Current [stock]:
  • Reverse Primer AGTTGCCCATCTTTCATCACTG 22 60.6 827-806 Spans exon 12/13
    • DGG ID: 2676
    • DGG name: AJ_Mm_HmbsR
    • Current [stock]:

Hspca

  • PrimerBank
  • GenBank Accession M36830
  • NCBI Protein Accession AAA37868
  • Species Mouse
  • Coding DNA Length 1041
  • Gene Description heat-shock protein hsp86.
  • Primer Pair Descriptions:
  • PrimerBank ID 194033a2
  • Amplicon Size 111
  • Genomic size 211

Sequence (5' -> 3') Length Tm Location

  • Forward Primer AATTGCCCAGTTAATGTCCTTGA 23 60.2 60-82
  • Reverse Primer TCGTAACGGATTTTATCCAGAGC 23 60.2 170-148
Personal tools