Gene Synthesis

Templateless PCR

Our goal in this session is to assemble Gene 68 gene from small pieces of DNA ~60 nucleotides long (called oligonucleotides or oligos). We use templateless PCR (also called Polymerase Cycling Assembly or Assembly PCR) to assemble the oligonucleotides into the full-length Gene 68. While this method effectively assembles the gene, it produces a relatively low yield of the full-length gene and many smaller fragments will also be produced. The Wikipedia site offers a useful introduction to polymerase cycling assembly: [1]

• Before you set up reactions, make sure you reserve a spot in the PCR machine.
• Set up your reactions on ice. Keep nucleotides and master mix on ice AT ALL TIMES!
• Be sure that each reagent is well mixed by pipetting up and down several times before using
  

You will be performing 3 reactions:

1. Assembly of Gene 68
2. A positive control reaction (a reaction that we know should produce large amounts of DNA)
3. A negative control reaction (a reaction that contains no input DNA and therefore should not produce any DNA; this is a check for contaminating DNA)

Procedure:

1. Obtain 3 PCR tubes (these are the small thin-walled tubes). Label the tubes 1-3.
2. To each tube, add the components listed below.

	Tube 1	Tube 2	Tube 3
	Assembly reaction	Positive control reaction	Negative control reaction
PCR master mix (buffer and enzyme)	10 ul	10 ul	10 ul
Nucleotides (1.25 mM)	5 ul	5 ul	5 ul
Oligos	5 ul of assembly oligos	5 ul of control oligos	5 ul of control oligos
DNA template	5 ul of water	5 ul of control template	5 ul of water
Total	25 ul	25 ul	25 ul

3. Cap your tubes and make sure that they are sealed tightly so that the liquid will not evaporate.
4. Place your tubes in the PCR machine in the position for which you signed up. Make sure that you have recorded which sample is in each position in the PCR machine.

Reaction Conditions:

1 cycle:

       94oC, 3 minutes

5 cycles:

       94oC, 30 seconds
       69oC, 30 seconds
       72oC, 1 minute

5 cycles:

       94oC, 30 seconds
       65oC, 30 seconds
       72oC, 1 minute

20 cycles:

       94oC, 30 seconds
       61oC, 30 seconds
       72oC, 1 minute

1 cycle:

       72oC, 3 minutes

Finish PCR

Templateless PCR produces a relatively low yield of the full-length gene; in fact, many smaller fragments that did not complete assembly are also produced. Polymerase chain reaction (PCR) is a technique that exponentially amplifies a template DNA sequence to increase its abundance (A good introduction to PCR is here: [2]).

While we used templateless PCR to produce a small amount of the full-length gene, the goal of Finish PCR is to exponentially amplify the full-length gene so that it becomes much more abundant. Following Finish PCR, most of the DNA present in the reaction mixture will be the full-length gene.

• Set up your reactions on ice. Keep nucleotides and master mix on ice AT ALL TIMES!
• Be sure that each reagent is well mixed by pipetting up and down several times before using

You will be performing 3 reactions:

1. Amplification of Gene 68
2. A positive control reaction (a reaction that we know should produce large amounts of DNA)
3. A negative control reaction (a reaction that contains no input DNA and therefore should not produce any DNA; this is a check for contaminating DNA)

Procedure:

1. Obtain 3 PCR tubes (these are the small thin-walled tubes). Label the tubes 1-3.
2. To each tube, add the components listed below. You will need to wait until the templateless PCR reactions have completed to add the Gene 68 template.

	Tube 1	Tube 2	Tube 3
	Amplification of Gene 68	Positive control reaction	Negative control reaction
PCR master mix (buffer and enzyme)	10 ul	10 ul	10 ul
Nucleotides (1.25 mM)	5 ul	5 ul	5 ul
Oligos	5 ul of amplification oligos	5 ul of control oligos	5 ul of control oligos
DNA template	5 ul of Gene 68 template	5 ul of PC template	5 ul of water
Total	25 ul	25 ul	25 ul

3. Once the templateless PCR reactions have finished, obtain two microcentrifuge tubes. Label one with your initials and “T-PCR NC”. Label the other with your initials and “T-PCR PC”.
4. Transfer the liquid from tube 3 of your templateless PCR (the negative control) to the “T-PCR NC” tube and put it away to be used next week. Transfer the liquid from tube 2 of your templateless PCR (the negative control) to the “T-PCR PC” tube and put it away to be used next week.
5. Find tube 1 of your templateless PCR (the assembly of the Gene 68). Add 175 ul of water to this tube (you can keep it in the small PCR tube). Mix well and use 5 ul of this mixture as the Gene 68 template for Finish PCR reaction 1 according to the table above.
6. Cap your tubes and make sure that they are sealed tightly so that the liquid will not evaporate.
7. Place your tubes in the PCR machine in the position for which you signed up. Make sure that you have recorded which sample is in each position in the PCR machine.

Reaction Conditions:

1 cycle:

      94oC, 3 minutes

25 cycles:

       94oC, 30 seconds
       55oC, 30 seconds
       72oC, 1 minute

1 cycle:

       72oC, 3 minutes

Designing oligos for gene assembly

Our goal is to build Gene 68 of the Mycopbacteriophage. Rather than ordering one piece of DNA that is the length of our gene (~426 bp), we order our DNA as oligonucleotides of approximately 60 bp. We must therefore first break our sequence into oligonucleotides (oligos). To design the Gene 68 oligos, we will use a program called Gene Design [3].

Step 1: To begin, we start with the nucleotide sequence of Gene 68.

ATGCCTAGCGCGAAGGCGATTGCCGCCGTGGCCAACGACCAACGCTGGCGCAAACAGGCC
GTGTGCCACCCGGCGCGCGGCCACAACCCCGAAATCTGGTTCCCGCCAACACCACGGCCG
TACGCCACCCGCGCCGAAGCCCGCGAAGCCACCGCCATCCGATTGCAGTGGGAGTCCGAA
GCGAAGGCGTTGTGCGCGCAGTGCCCGGTACGGCTCGAGTGCCTCGAATACGCCAACGAC
AACGACGAACGGGAGGGGATCTGGGGCGGACTGACAGTTACCGAACGCGGCCTAACACCT
TTGCGATAA

Step 2: From the GeneDesign homepage, click “Building Block Design (Sequence overlap)”.
Make sure the settings are:
“Target oligo length” of 60 bp
“Overlap melting temperature” of 56deg
Make sure that “generate gapped oligos” is selected
Make sure that “maximum allowable oligo length” is set to 60
Click “Design oligos”. Notice that in the second white box at the top you see four DNA strands: the top and bottom strands are the two complete strands of the final assembled gen. The middle strands depict the overlapping oligos that can be used to synthesize the gene.

Step 3: While we can synthesize the preexisting Gene 68 using the oligos we designed in step 2, we can also change or re-design the gene in several ways to make it different from the natural sequence. As an example, we will recode the gene by changing the DNA sequence that encodes the Gene 68 protein.

From the GeneDesign homepage, click on “Design a Gene”. Enter the amino acid sequence of Gene 68:

MPSAKAIAAVANDQRWRKQAVCHPARGHNPEIWFPPTPRPYATRAEAREATAIRLQWESE
AKALCAQCPVRLECLEYANDNDEREGIWGGLTVTERGLTPLR

Click on “E. coli” and then “Reverse Translate”. You should get a nucleotide sequence as an output from the program. This nucleotide sequence now uses the preferred codons of E. coli to encode Gene 68.

Step 4: Click “BB Design (Sequence overlap)” to break the E. coli optimized Gene 68 gene into overlapping oligonucleotides.
Make sure the settings are:
“Target oligo length” of 60 bp
“Overlap melting temperature” of 56deg
Make sure that “generate gapped oligos” is selected
Make sure that “maximum allowable oligo length” is set to 60

Step 5.Click “FASTA format: Assembly oligos” and the program will provide you with a list of the oligos that can be used to synthesize the designed Gene 68. These oligos have been ordered from a commercial DNA synthesis company and have been combined together to create the assembly oligos that we used in the templateless PCR.