Harvard:Biophysics 101/2007/Notebook:Denizkural/2007-3-15

From OpenWetWare

Jump to: navigation, search

Private Challenge Sequence

What is the significance of this sequence?

ctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagct
cccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctg
tgctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagtt
aaaattcccg

Manual Analysis

First, I did a blast search with the new beta version, with the results:


>ref|NT_030059.12|Hs10_30314 Download subject sequence spanning the HSP Homo sapiens chromosome 10 genomic contig, reference assembly
Length=44617998

 Features flanking this part of subject sequence:
   3895 bp at 5' side: hypothetical protein
   425 bp at 3' side: HtrA serine peptidase 1


 Score =  736 bits (398),  Expect = 0.0
 Identities = 400/401 (99%), Gaps = 0/401 (0%)
 Strand=Plus/Plus

Query  1         CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  60
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968870  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  42968929

Query  61        CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  120
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968930  CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  42968989

Query  121       CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  180
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968990  CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  42969049

Query  181       CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  240
                 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct  42969050  CGCGGACGCTGCCTTCGTCCGGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  42969109

Query  241       ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  300
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969110  ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  42969169

Query  301       CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  360
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969170  CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  42969229

Query  361       GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC  401
                 |||||||||||||||||||||||||||||||||||||||||

We observe one SNP between 181 and 240 on our query, as you can see above.

And then, we follow the link to the HtrA, which gives a link to OMIM #610149, which is describes how a certain SNP increases risk for Macular age-related macular degeneration, and provides an SNP reference, so we view the SNP:

http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs11200638

which corresponds to the SNP we identified with BLAST.

Lay-person recommendation

Inform them that they are at a higher risk for age-related macular degeneration due to a rare mutation. If the person is of Asian origin however, I would double-check my results. Then I would refer them to a specialist on age-related macular degeneration, and ask them if their relatives had this problem in old age.

Personal tools