IGEM:Harvard/2006/Adaptamers/Oligos

From OpenWetWare

Jump to: navigation, search


Contents

v.1

  • Oligos (8 ssDNA sequences):

SN = streptavidin aptamer + N bp 3' tail

TN = thrombin aptamer + N bp 3' tail

S5

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGCATAG 3'

S20:

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGCATAGAGCATCTAGAGGTTC 3'

S35:

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGCATAGAGCATCTAGAGGTTCACTTCTGCAGCAATA 3'

S50:

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGCATAGAGCATCTAGAGGTTCACTTCTGCAGCAATAGAATTAAGCTTGTCC 3'

T5:

5' GGTTGGTGTGGTTGGACACT 3'

T20:

5' GGTTGGTGTGGTTGGACACTGAACCTCTAGATGCT 3'

T35:

5' GGTTGGTGTGGTTGGACACTTATTGCTGCAGAAGTGAACCTCTAGATGCT 3'

T50:

5' GGTTGGTGTGGTTGGACACTGGACAAGCTTAATTCTATTGCTGCAGAAGTGAACCTCTAGATGCT 3'


  • Alignment

+20:

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGCATAGAGCATCTAGAGGTTC                        3'
3'                                              TCGTAGATCTCCAAGTCACAGGTTGGTGTGGTTGG    5'

+35:

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGCATAGAGCATCTAGAGGTTCACTTCTGCAGCAATA 				3'
3'                                              TCGTAGATCTCCAAGTGAAGACGTCGTTATTCACAGGTTGGTGTGGTTGG      5'        

+50:

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGCATAGAGCATCTAGAGGTTCACTTCTGCAGCAATAGAATTAAGCTTGTCC			  3'
3'                                              TCGTAGATCTCCAAGTGAAGACGTCGTTATCTTAATTCGAACAGGTCACAGGTTGGTGTGGTTGG 5'

v.2

T50.2

5' GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTAGCAATGATAGGCATATTTATACGGCTCGGA 3'

T35.2

5' GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTAGCAATGATAGGCATA 3'

T20.2

5' GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTA 3'

S50.2

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGTTCTTTCCGAGCCGTATAAATATGCCTATCATTGCTAATCCTTTCCATAC 3'

S35.2

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGTTAAATATGCCTATCATTGCTAATCCTTTCCATAC 3'

S20.2

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGTTTGCTAATCCTTTCCATAC 3'

A15

5' TCTGTGAGACGACGCACCGGTCGCAGGTTTTGTCTCACAGTTGCTTTCCATTCTACATATGAAGGTTGGTGTGGTTGGAAGTAATGTAGAATGGAAAG 3'


  • Alignment

A50.2

GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTAGCAATGATAGGCATATTTATACGGCTCGGA
   		    CATACCTTTCCTAATCGTTACTATCCGTATAAATATGCCGAGCCTTTCTTGACACTCTGTTTTGGACGCTGGCCACGCAGCAGAGTGTCT      

A35.2

GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTAGCAATGATAGGCATA
		    CATACCTTTCCTAATCGTTACTATCCGTATAAATTGACACTCTGTTTTGGACGCTGGCCACGCAGCAGAGTGTCT

A20.2

GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTA
		    CATACCTTTCCTAATCGTTTGACACTCTGTTTTGGACGCTGGCCACGCAGCAGAGTGTCT

Biotinylated oligos

Biotinylated oligos as positive control in viscosity experiment:

5' and 3' biotinylated:

B35.0

5' GAGTTATGATTAGGCGGACGGTCTGAACAAGGTTT 3'

5' biotinylated:

B35.1

5' TGAGTTATGATTAGGCGGACGGTCTGAACAAGGTTT 3'

B35.2

5' TAAACCTTGTTCAGACCGTCCGCCTAATCATAACTC 3'

Strand Displacement Oligos

R20.20

5' TAATCCTTTCCATACTACTT 3'

R20.35

5' TAATCCTTTCCATACTACTTCCAACCACACCAACC 3'


T20-R20.20


5' GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTA 3'
3' 	          TTCATCATACCTTTCCTAAT 5' 

T20-R20.35


5' GGTTGGTGTGGTTGGAAGTAGTATGGAAAGGATTA 3'
3' CCAACCACACCAACCTTCATCATACCTTTCCTAAT 5'

Personal tools