IGEM:Harvard/2006/Fusion proteins/Oligos

From OpenWetWare

Jump to: navigation, search


Streptavidin primers

StrepF, forward primer for SA, no start codon

5' GTTTCTT C GAATTC GCGGCCGC T TCTAGA [GCTGAAGCTGGTATCACCGG] 3'

StrepR, reverse primer for SA, no stop codon

5' GTTTCTT C CTGCAG CGGCCGC T ACTAGT [GGAAGCAGCGGACGGTTTAA] 3'

StrepFS, forward primer for SA w/ start codon

5' GTTTCTT C GAATTC GCGGCCGC T TCTAGA [ATGGCTGAAGCTGGTATCAC] 3'

StrepRS, reverse primer for SA w/ two stop codons

5' GTTTCTT C CTGCAG CGGCCGC T ACTAGT [TTATTAGGAAGCAGCGGACG] 3'

StrepMF, forward primer for mutagenesis removing XbaI site in SA

5’ CTGAAAGCCGCTACGTTCTGACCGGTCGT 3’

StrepMR, reverse primer for mutagenesis removing XbaI site in SA

5’ ACGTAGCGGCTTTCAGCGTTACCAACAGC 3’

StrepMF2, alternate forward primer for mutagenesis removing XbaI site in SA

5' CTGAATCGAGATACGTTCTGACCGGTCGT 3'

StrepMR2, alternate reverse primer for mutagenesis removing XbaI site in SA

5' ACGTATCTCGATTCAGCGTTACCAACAGC 3'

StrepHR, reverse primer for SA+His6tag, no stop codon

5' GTTTCTT C CTGCAG CGGCCGC T ACTAGT [ATGGTGGTGATGGTGATGGG] 3'

StrepHRS, reverse primer for SA+His6tag w/ two stop codons

5' GTTTCTT C CTGCAG CGGCCGC T ACTAGT [TTATTAATGGTGGTGATGGT] 3'

OmpA primers

OmpAF, forward primer for full OmpA

5' GTTTCTT C GAATTC GCGGCCGC T TCTAGA G [atgaaaaaga cagctatcgc] 3'

OmpAR, reverse primer for full OmpA

5' GTTTCTT C CTGCAG CGGCCGC T ACTAGT A [ttaagcctgc ggctgagtta] 3'

OmpA46F, forward primer for OmpA starting aa 46

5' GTTTCTT C GAATTC GCGGCCGC T TCTAGA [aacccgtatgttggctttga] 3’

OmpA66R, reverse primer for OmpA ending aa 66

5’ GTTTCTT C CTGCAG CGGCCGC T ACTAGT [GCTGCCTTTGTACGGCATAC] 3’

OmpA159R, reverse primer for OmpA ending aa 159

5’ GTTTCTT C CTGCAG CGGCCGC T ACTAGT [GTTGTCCGGACGAGTGCCGA] 3’

Lpp primers

LppF, forward primer for Lpp

5' GTTTCTT C GAATTC GCGGCCGC T TCTAGA [atgaaagctactaaactggt] 3’

Lpp29R, reverse primer for Lpp ending aa 29

5’ GTTTCTT C CTGCAG CGGCCGC T ACTAGT [CTGATCGATTTTAGCGTTGC] 3’

Lpp78R, reverse primer for Lpp ending aa 78

5’ GTTTCTT C CTGCAG CGGCCGC T ACTAGT [CTTGCGGTATTTAGTAGCCA] 3’

Lpp78RS reverse primer for Lpp ending aa 78 and stop codon

5’ GTTTCTT C CTGCAG CGGCCGC T ACTAGT [TTACTTGCGGTATTTAGTAG] 3’
Personal tools