Jessica Keenan: Luciferase siRNA

Day 4 For Next Time

Sample	Volume for 1ug	Volume for 2ug	Volume for 4ug	Volume for .5ug
Plasmid Only (No siRNA) Replicate 1 (2a)	1ug/(712ug/ml x 1ml/1000ul) = 1.40ul	2ug/(712ug/ml x 1ml/1000ul) = 2.81ul	4ug/(712ug/ml x 1ml/1000ul) = 5.62ul	.5ug/(712ug/ml x 1ml/1000ul) = .70ul
Plasmid with Experimental Insert Replicate 2 (6b)	1ug/(256ug/ml x 1ml/1000ul) = 3.91ul	2ug/(256ug/ml x 1ml/1000ul) = 7.81ul	4ug/(256ug/ml x 1ml/1000ul) = 15.63ul	.5ug/(256ug/ml x 1ml/1000ul) = 1.95ul

(sample concentration) x (what volume?) = (desired mass)

(what volume?) = (desired mass)/(sample concentration)

Day 2 For Next Time

Luciferase Assays

The graph depicting the results of the practice luciferase assays and the normalized data can be found here.

The cells which have not received DNA or siRNA could be used to detect background, because they do not produce any light of their own since they have not been transfected with the plasmid containing luciferase genes. They are essentially wild type mouse embryonic stem cells, and thus any light detected from them would be background. Cells containing the luciferase genes could also be used if no luciferin is added before measuring the light emission. In addition to background from the environment, this would also take any background light the proteins might be able to emit in the absence of luciferin (which, in theory, should be none, but perhaps the enzymes are able to emit light by acting to some extent on other components of the reaction).

After normalizing the Renilla light measurements to the Firefly light measurements, a value < 1 indicates that the Renilla luciferase is expressed less than the firefly luciferase. A four-fold increase and a four-fold decrease would not be visually equivalent if plotted on the X-Y axis. A four-fold decrease would be represented by the value .25, while a four-fold increase would be represented by the value 4.

Day 1 For Next Time

Expected Cell Count

(49 cells on average/4x4hemocytometer grid) x 10^4 = 4.9x10^5 cells/ml

4.9x10^5 cells/ml x 3ml/well x .25 (plating efficiency) x 2^4 (the cells will be checked 5 days after they were seeded. The first day, they will not double because they are recovering from the trypsin. However, they will double each of the next four days, and thus there will be 2^4 times more cells on 10/16 than on 10/11) = 5.9x10^6 cells/well

Dharmacon siRNA Targets

Dharmacon and Ambion use very different criteria in their siRNA design (though some aspects are similar).

Ambion looks for targets that:

• Begin with 'AA'
• Have 30%-50% G/C content
• Avoid sequences of > 4 Ts or As
• They also suggest BLASTing the sequence against the genome of the organism in which it will be used to ensure specificity. They suggest not using any target that matches 16-17 contiguous nucleotides elsewhere in the genome

Dharmacon looks for targets that:

• Have a low G/C content
• Have low stability of the the sense strand at the 3' terminus
• Lack inverted repeats
• Contain certain preferred base pairs at positions 3, 10, 13, and 19
• These targets also appear to be shorter

Despite the differences between their search criteria, Dharmacon's target results are very similar to Ambion's, though none are exact matches. Parts of all of the targets returned by the Ambion search are found within many of Dharmacon's targets. However, Dharmacon's targets tend to be shifted in the nucleotide sequence. Perhaps this is because the two algorithms classify the same areas as targets, but Ambion requires the target to start with 'AA,' while Dharmacon does not utilize this criterion. Because none of the targets are exact matches, it is difficult to determine exactly how the targets from Ambion rank compared to Dharmacon's targets. Specifically, the target we chose based on Ambion's search results is Dharmacon's 11th ranked target shifted by one nucleotide (they also differ in size):

AAGGTTACAAGACAGGTTTAA <- Target based on Ambion's search

CAAGGTTACAAGACAGGTT <- Target based on Ambion's search (ranked 11th)