KAD062806-Construction of J23006

From OpenWetWare

Jump to: navigation, search

PCR KB001/KB002 on pSB1A2-S03155 (230 bp, EcoRI/XbaI, Neb2)
Paste into pSB1A3-I13521 (EcoRI/XbaI, Large-~3KB)
Product is J023006


KB001 Forward EcoRI to construct Ptet part-making biobrick plasmid
ttctggaattcgcggccgcaactagagccaggcatc
KB002 Reverse XbaI to construct Ptet part-making biobrick plasmid
ccgctTctagAagtgctcagtatc

Personal tools