Michael R. Pina Week 2

From OpenWetWare

Jump to: navigation, search

Contents

Week 2

(a) and (b)

Allele/Color Change(s) in amino acid sequence Change(s) in DNA sequence
Green TyrTrp ACTGGC
Red PheCys TCTGTC
Blue TyrCys ACTGTC
Yellow TrpCys GGTGTC
White Any other combination Any other combination

Are all the white alleles the same?

No, there are only a few amino acid sequences that are responsible for pigmentation (near base pair 80); if it is any other of the amino acids then the resultant flower will be white.

(c)

Green-1

Upper (green)

CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT

Lower (green)

CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT

Green-2

Upper (blue)

CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT

Lower (yellow)

CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT

Red

Upper (red)

CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT

Lower (white)

CAGCTATGACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT

White

Upper (white)

CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT

Lower (white)

CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT

By an eye-ball comparison it is easy to note that all of the DNA sequences are identical until base pair 79.

(d)

To create a true breeding purple flower, a mutant was created by adding the DNA sequence "ACTTCT" starting at base pair 79. "ACTTCT" codes for the amino acid sequence Tyr-Phe. It was found that Tyr causes blue pigmentation and Phe cause red pigmentation, and when placed together they result in a purple mutant. For more detail on this process, take a look at my lab notebook.

Class Journal Entries Individual Journal Entries My Lab Notebook
Class Journal Week 2 Individual Week 2 Lab Notebook
Class Journal Week 3 Individual Week 3
Class Journal Week 4 Individual Week 4
Class Journal Week 5 Individual Week 5
Class Journal Week 6 Individual Week 6
Class Journal Week 7 Individual Week 7
Class Journal Week 8 Individual Week 8
Class Journal Week 9 Individual Week 9
Class Journal Week 10 Individual Week 10
Class Journal Week 11 Individual Week 11
Class Journal Week 12 Individual Week 12
Class Journal Week 13 Individual Week 13
Back to Main Page
Personal tools