PTrc99A

From OpenWetWare

Jump to: navigation, search
SAUER LAB

Home        Protocols        Lab Members        Materials        Equipment        Links        Internal       

Sauer:plasmid vectors

gtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtca ggcagccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgca taattcgtgtcgctcaaggcgcactcccgttctggataatgttttttgcg ccgacatcataacggttctggcaaatattctgaaatgagctgttgacaat taatcatccggctcgtataatgtgtggaattgtgagcggataacaatttc acacaggaaacagaccatggaattcgagctcggtacccggggatcctcta gagtcgacctgcaggcatgcaagcttggctgttttggcggatgagagaag attttcagcctgatacagattaaatcagaacgcagaagcggtctgataaa acagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgc cgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccc catgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagt cgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc ctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacg gcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaa ttaagcagaaggccatcctgacggatggcctttttgcgtttctacaaact ctttttgtttatttttctaaatacattcaaatatgtatccgctcatgaga caataaccctgataaatgcttcaataatattgaaaaaggaagagtatgag tattcaacatttccgtgtcgcccttattcccttttttgcggcattttgcc ttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaa gatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcgg taagatccttgagagttttcgccccgaagaacgttttccaatgatgagca cttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccggg caagagcaactcggtcgccgcatacactattctcagaatgacttggttga gtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagag aattatgcagtgctgccataaccatgagtgataacactgcggccaactta cttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaa catgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatg aagccataccaaacgacgagcgtgacaccacgatgcctacagcaatggca acaacgttgcgcaaactattaactggcgaactacttactctagcttcccg gcaacaattaatagactggatggaggcggataaagttgcaggaccacttc tgcgctcggcccttccggctggctggtttattgctgataaatctggagcc ggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaa gccctcccgtatcgtagttatctacacgacggggagtcaggcaactatgg atgaacgaaatagacagatcgctgagataggtgcctcactgattaagcat tggtaactgtcagaccaagtttactcatatatactttagattgatttaaa acttcatttttaatttaaaaggatctaggtgaagatcctttttgataatc tcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgt aatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtt tgccggatcaagagctaccaactctttttccgaaggtaactggcttcagc agagcgcagataccaaatactgtccttctagtgtagccgtagttaggcca ccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcc tgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttg gactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggg gggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactga gatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggaga aaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggt ttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagggggg cggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggc cttttgctggccttttgctcacatgttctttcctgcgttatcccctgatt ctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgc agccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgca tatggtgcactctcagtacaatctgctctgatgccgcatagttaagccag tatacactccgctatcgctacgtgactgggtcatggctgcgccccgacac ccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatc cgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggt tttcaccgtcatcaccgaaacgcgcgaggcagcagatcaattcgcgcgcg aaggcgaagcggcatgcatttacgttgacaccatcgaatggtgcaaaacc tttcgcggtatggcatgatagcgcccggaagagagtcaattcagggtggt gaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtct cttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcg aaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcc caaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcg ttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcg attaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggt agaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcg cgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggat gccattgctgtggaagctgcctgcactaatgttccggcgttatttcttga tgtctctgaccagacacccatcaacagtattattttctcccatgaagacg gtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatc gcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggc tggctggcataaatatctcactcgcaatcaaattcagccgatagcggaac gggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatg ctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagat ggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtg cggatatctcggtagtgggatacgacgataccgaagacagctcatgttat atcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaac cagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggca atcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgccc aatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagct ggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaatt aatgtgagttagcgcgaattgatctg

Personal tools