SbpA DNA Sequence

From OpenWetWare

Jump to: navigation, search

ATAGATTAAGCTTTTTATTTAATAAAGAAGAAACTCATAAAGTTGTTGGGGAAGAGGCAGATTTCGCTAA GAAACGCCTTCTATATTTCTGTTTCTTTACAATTATAACTAAAATATTACGGGAGTCTTTAATTTTTGAC AATTTAGTAACCATTCCAGAAAATGCTTGGTTATTATTGAGAGTAAGGTATAATAGGTAACGGAACTATA TGTTACCAATCCAAATGAGGATATAATTAGTTGTAATTTTAATGGGTTTCTATTAAATACCATATAAGGT ATGGTAAAAAAATCTTCTATAACTAAATTTATGTCCCAATGCTTGAATTTCGGAAAAGATAGTGTTATAT TATTGTAGAAAGTGAATAAACTTACTAGAATGGTATTCTACTACGCTTTTTCTAGTAAATTTACTAACAA ATTTGCTTTAGTTTTGTATTATTCAAGAAAGCTATAATACATACATTTAGGTAACTAGGCGGTACTATAG TTTTCGTTGGATTAATATCAATTTAAGGAATTTTAGGGAGGAATACATTAATGGCAAAGCAAAACAAAGG CCGTAAGTTTTTCGCGGCATCAGCAACAGCTGCATTAGTTGCATCAGCAATCGTTCCTGTAGCATCTGCT GCGCAAGTAAACGACTATAACAAAATCTCTGGATACGCTAAAGAAGCAGTTCAATCTTTAGTTGATCAAG GCGTAATCCAAGGTGATACTAACGGGAACTTCAACCCACTTAACACAGTAACTCGTGCACAAGCTGCAGA AATCTTCACGAAAGCTCTAGAATTAGAAGCTGACGGCGATGTAAACTTCTCAGACGTTAAAAAAGGTGCT TGGTACTACAACTCAATCGCAGCAGTAGTAGCAAACGGCATTTTTGAAGGTGTAAGTGCAAACGAATTCG CACCAAACAAATCTTTAACTCGTTCTGAAGCAGCTAAAGTTCTTGTAGATGCTTTCGGTTTAGAAGGTAG CGAAAGCTTAAGCCAATTCGCTGACGCTTCTCAAGTAAAAGGTTGGGCTAAATCTGCTCTAGAAACTGCT GTAGCAAACGGAATCTTCACTGGTTCTGAAGAAAACGGTAAATTAAACCTTAAACCAAACGCAGCAATCA CTCGTCAAGACTTCGCAGTAGTTTTCGCTCGTACGCTTGATCTAGCTGTTGAAACAGTTGACGCTTCTGT AAAAGCTATCAACAACACAACTGTTGAAGTAACATTCGACGAAGAAGTTGATAACGTAGAAGCTCTTAAA TTCAAAATCGAAGGCTTAGAAGTTAAAAACGCAGCTGTTAAACAAACTAACAAAAAAGTTGTTGTATTAA CTACTGAAGCTCAAACTGCTGACAAAGAGTACGTTGTAACTCTTGATGGCGAAGAAATCGGTAAATTCAA AGGTATCGAAGCTGTAGTTCCAAAATCAATCGTATTAAAAACTACTAATACACAAGGTAAAGTAGGTAAC CAAGTAACACTTACTGCTGATGTGGGCGTAAAAGCTGCTGGTATTCCTGTAACTTTCAACGTTGATGCTC CAACTGGTTCTTTAAACAAAGATGCTGTTGTTGAAGTTTACACTAACGCTGAAGGTATTGCTTCTTACTC TTACACTCAATATGCACCAGATGCTGATGATGTAACTGTTTACCCAACAGGTGCTCCTCAATTACGTGCA TTCGGACCTGTGTACTGGGGCGTTGACAACATCTTAACTATTGAAGAAGTTACTACTGGTAACACATTAG CTAACGGTGTTAAGAAGACTTATAAAGTAACATTCAAAGACCCTAAAACAGGTGCTGCTCTTACAAATAA AAAATTAAACGTATCATTTGTAGAAAACACAAATGTTGCATTTAATGCTATTTCAAAAGCAACAGTTACT AATCCATCTAGTGGTTTAACAGTAACTCCATACCAAACTACTACTGGTTTACAAGAAGAAATCCAAGTAA CAACTGATTCTAACGGTCAAGCTACATTTGTAGTTTCTGGTACAAACACTGCTGTAACACCTTACGTATT CGTTGACGGTTCAAGCTCTGTATTAGGCGTTTCAACTGTAACTGGTACTAACAATGTTACACAAGCTACT ACTGCAAACAAAAAATGGGAAGCAACTGAATTAACGGCTACTGCAGCTCAAGTTAAATTCGAAGGTGCTC AATTAAACCACCAAATCACTGTTGAACGTGACGGTGAAGAAGAAGCAGCAGCTCAATACGGTTCTAAATT AAACGGTCGCGAATATAAAGTTAAAGTTCTTGACAAAGACGGTAAACCATACGCAAATGGTTTAGTTAAC ATTGGACTTGATGAAGTACTTGATCGTAACTTAAATACAAATTCTAAAGCTCAATTTGCTAATGTAACAG ATGGTACTGCACTTACTTTAAATCCTGGTACTTCTCAACAAGGTAAAATTAAGCTAAACTCAAAAGGTGA AGCAACAGTTGTTCTTTACGGAGCAAAAGGTGAAGTGGGAACTCCAGTAGTATGGATCGACCAAAATACT TCTCAAAACAACCAATCAGGTGTATTAGAAGATGGTGAGCCATTCTTCAAAGCGCCAGTTTCTAACTTCC AATATGAGCGTGTAATGGGTGCTGAATTCACAGTTGAAGGTAAAACTTCAAACCAAAATGTAGGCACTGA TGGTATCGCAAACTATGCATTCGCTCTAACAAACCAAAGTGGTAAAACATTAACGAATTTAATTGGTAAA ATGACTTACGAAATCCGTAATACAAGTGGTCAACCAATTGAAGTTAAAACTCCAATTTCTTACCGCGACC AAAATAATGTATCATCTACATTATTTAAAATCGAAGAATATGGTAGCATTACAATTTCTGCTGATGTAAT AAGCACTAGCAATGCAGCATTCACTATTGAAACTGCTCCAAATGGTAAAGCAGCTACTGTAGTTGTAACT CCATCATTCGTTACAGCTAACAACTTCGATGCAAGTGCTGATAACAACCTAAATGGTGTTGTTACAGATG CACGTGACTTCAATAAGCATGTTACAGCTCCTGCTTTAACAGCTACATTCGGTAACAACAAAGAAGTTGG AACTAACTATACAGGTACTGTTCAATACTTCAATAAAGATAAGAAAACAATTACTTTCAACGGTAAAAAT GCAGTTAAATACGCTGGGGAATCTGGTAAAACTTACAAATACTTCGGTCTTGGAAGTACGCCAATCTCAA CAGCTGATGACTTCATTACTCAATTACAAAATAATGCTGCTAATGGCTCAGTTACAGTAACTTATAAAGT AGTAGACAATGAAGTACAATTCTACATTGTAAGCTTTAACAATGATGGTGCTGCTAATGCTGTAAAACCA GAACCAACAGCTGTAGCACCAACTGACGGTACAGTTGCATTTACTAACACATCATTTAATGCAAGCGCAA ACCAAACAATTACTGTAACAGATGCTGATTTAAATGCTGATGCAACAGTAGCTGAAACTACAACAGTTAA AGTAACTTCAGGCACAGTTGTTTATACATTAACTGCTACTGAAACTGGTGTAAATACTGGTGTATTCACA GCTACTTTAACAGCTGCACAATTAGCTGTTTTATCTGACGGTGTAATTACAGCAACTTATGAAGACGTTA AGAATACAACTGGTTCTTCAGTAACACGCACAGCTACAGCTACGTTAAATACAGTTGTAGGTCAAGTAAA CTACAATGCGGCAGCAACTACTGCATATTCAGAAGGTAATCCAGTAGCAGCTACATTAACAGGTACTGGT TTAACGCAAGTTATTGGCGGTGGTGCATTAGTAATGAAGATTAATGGCACTCAATTCACTACAAATGTAA CTGCTATCAATCCTGGTACAAGTGTTGCAGATAGTGCAGCAGCAGTAGCAGGTGAAATTAACGCAGCAGC AGTAGCAGCTGGAATTATTACAGCACCAGCAACAGTTGCAACTGTAAATGGTACAAATAACATTGTAATT ACTAGCCCAACTGCAGCAGGTTCAACTGTAGAAGTAGTATCTAACGCTGCAACTGGTACTGGTTTAGTGG TTGCATCAGCATCTGCTACAACTTCTGCACCAGTGAAAGCTGCATGGAAATTCACTTTAACAACAACTCC AGCTGTTGGTGAAAAAATCACAGTTAAAGTTGGTAATGTAGAGAAGACTTATACTGTCGCTCTAGGTGAT ACTTTAACTACTATCGAAACAGCTTTAAACACTGCATTTGGTACTGACTTTGATGTTACTTTAGCTGCAG GTTCAAATGTGTTCACTGTAACTCAAGATGTGGCAGCTCCGACAACAGCTGAATTAACAGTAACAATTAC AAAATAATTTTAGAATTTATTCTACTAGTTTTTAACTAAATGAATACTTCTAGCATTTAAATAGCTCTGT AGAGAGAAATCTCTACAGAGCTATTTGTATTCTATCTATAATAAAAGAGTGCTATTATAT

Personal tools