User:Ana Isabel F. Simoes/Notebook/Ana Simoes-biomol/2010/03/09

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

TP2

Gene e mRNA

A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA



  • Que diferenças encontra e qual a sua origem?

A sequência correspondente ao mRNA da beta-globina apresenta um alinhamento significativo com o DNA do gene da beta-globina, no entanto no mRNA estão ausentes os intrões.


  • Onde se inicia a transcrição e porquê?

No iniciador, devido à presença prévia de TFIIB e TATA, que promovem a ligação da RNA polimerase e como tal promovem o inicio de transcrição.


  • Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica?

Tendo sido convencionado o sentido 5'-3', para cada sequência obteve-se 3 frames nesse sentido.


No caso do DNA verifica-se a presença de um caos genómico, devido à grande quantidade de codões stop e às pequenas sequências entre Met e codão stop, não sendo possivel identificar proteínas, o que resulta da presença de intrões.


No caso do mRNA, estas são as melhores frames: dado que os intrões estão ausentes e as sequências entre Met e codão Stop são mais longas e como tal já permitem a identificação de proteínas:

5'3' Frame 3 I C F Stop H N C V H Stop Q P Q T D T Met V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R L L G N V L V C V L A H H F G K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y H Stop A R F L A V Q F L L K V P L F P K S N Y Stop T G G Y Y E G P Stop A S G F C L I K N I Y F H C K K K K

3'5' Frame 3 F F F L Q Stop K Stop Met F F I R Q N P D A Q G P S Stop Y P P V Stop Stop L D L G N K G T F N R N W T A R K R A Stop Stop Y L W A R A L A T P A T T F Stop Stop A A C T G G V N S L P K Stop W A S T Q T S T L P R S L K F S G S T C S L S Q C S S L S V A K V P L R L S R Stop A R P S L K A P S T F L P Stop A F T L G L P I T A S G V D R S P K D S K N L W V Q G Stop T T S S L P R A S P P T S S T F T L P H R A V T A D F S S G V R C T Met V S V Stop G C Stop Stop T Q L C Q K Q Met

Neste caso os intrões estão ausentes e as sequências entre Met e codão Stop são mais longas e como tal já permitem a identificação de proteínas.

  • Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)?

As bactérias não sofrem splicing ao contrario das leveduras que ja removem alguns dos intrões. Daqui resulta que o transcrito nas bactérias seja muito longo (integral) enquanto que nas leveduras já se obtém um transcrito mais pequeno.


  • As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração?

As bactérias não conseguem processar o genoma humano, dado que este contém intrões (ausentes nas bactérias) e promotores diferentes destas. Para se produzir uma proteína humana, e uma vez que o mRNA (onde os intrões estão ausentes) é muito instável, é necessário produzir-se cDNA a partir deste mRNA com promotores caracteristicos das bactérias para que estas possam então "ler" essa informação.



Personal tools