The Daily Grind
- Test Amy's fungal sequences with tRIFLE on downstairs computer (excel file already there saved)
- Ensure Keri orders fungal primers for TRFLP
- Look over evidence of fungus cause of TVD - read about the fungi
- Seems to me that for the tomato work, I'm going to go over all the already collected samples with a fungal tooth comb and see what there is to see. This will include community bacterial, fungal, and nematode TRFLP, alongside fungal pathogen specific qPCR
- For California work, I will do the same, but include bacteria too, then zoom in to quantify specific pathogens (V. dahliae, Phytophthora fragaria, Macrophomina - need primers for these) with qPCR
- V. dahliae specific primers against β-tubulin are VertBt-F AAC AAC AGT CCG ATG GAT AAT TC and VertBt-R GTA CCG GGC TCG AGA TCG (from http://apsjournals.apsnet.org/doi/pdf/10.1094/PHYTO-97-7-0865)
- P. fragaria specific primers require a nested approach. First, a Peronosporales specific reaction with forward 5'GAGGGACTTTGGGGTAATCA 3' DC6 and reverse ITS4, followed by a fragaria specific reaction using P. fragariae forward 5'ACTTAGTTGGGGGCCTGTCT 3' DC1 and P. fragariae/cambivora/cinnamomi reverse 5'CGCCGACTGGCCACACAG 3' DC5 (Tm= 62oC)(http://www.scri.ac.uk/webfm_send/548)
- Macrophomina phaseola can be detected using qPCR and primers: MpSyK F ATCCTGTCGGACTGTTCCAG and MpSyK R CTGTCGGAGAAACCGAAGAC. These can be used for real time PCR. Reference is: http://www.mycologia.org/content/103/3/466.abstract
|