User:Ines Sofia Silva Vieira/Notebook/Bio Molec - caderno/2010/03/16

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

TP3

Sequenciação de DNA

Introdução

As sequências de genes e mRNAs com que temos vindo a trabalhar foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing

Note que o resultado de uma sequenciação é um electroferograma, que depois é convertido em "As, Cs, Gs e Ts" por um programa informático.



[edit] Questões O que é necessário para fazer uma reacção de sequenciação? São necessários Primers(complementares ao DNA a sequenciar), polDNA, os 4 dNTPs(A;T;C;G),a cadeia de DNA codificante a replicar(DNAtemplate) e didesoxinucleótidos(ddNTPs).


Que cadeia é sequenciada?

A cadeia a ser sequenciada é aquela na qual se encontra o primer, a este vão ser adicionados nucleótidos formando uma nova cadeia que vai ser igual à cadeia complementar da cadeia molde. 

Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?

Esta sequenciação é considerada por terminação devido à adição de didesoxirribonucleótidos que vão bloquear o crescimento do DNA em replicação ao serem incorporados pela DNA pol no DNA a sequenciar. Estes nucléotidos apesar de semelhantes aos dNTPs, não possuem a extremidade 3'OH e por isso não permitem que a ligação seguinte pelo dNTP seja formada.


Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?


A sequênciação não termina no primeiro nuclótido de cada tipo porque em cada fragmento o primeiro nucleótido pode não ser um ddNTP e assim o crescimento da cadeia não é impedido. Para além disso, a proporção de ddNTPs deve ser muito inferior à de dNTPs.


Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?


Existem alguns problemas aparentes.A baixa intensidade e a diminuição da resoluçao no final da sequenciação são os mais evidentes.

Em primeiro lugar é perceptivel uns picos de intensidade de fluorescência reduzida. Esta intensidade é reduzida quando temos fragmentos de grandes dimensões e a polimerase tem dificuldade em ligar-se a apenas um nucleótido (são formadas moléculas mais pequenas).

Para além disto, temos picos mais largos devido a falhas na electroforese(diminuição da resolução) em que se torna dificil distinguir fragmentos de DNA de dimensão semelhante(começa a haver sobreposição dos mesmos).


O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?

Para analisarmos o fragmento completo poderíamos inicialmente sequenciar a primeira porção do nosso DNA e seguidamente proceder à elaboração de um primer correspondente à região terminal dessa porçao para desta forma por 'pedaços' conseguirmos obter a sequência completa . Outro método consiste na fragmentação do DNA sendo feitas sobreposições conseguindo-se com auxilio computacional recriar a sequência completa.

Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?

preto G, vermelho T, azul C , VERDE A

Individuo 1: TCGTGTTCTATGATCATGAGAGTCGCCG

Individuo 2: TCGTGTTCTATGATGATGAGAGTCGCCG (Os picos preto(G) e azul(C) encontram-se sobrepostos o que pode indiciar uma situação de heterozigotia)


Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?

Este gene encontra-se presente em qualquer célula do organismo, para isso recolheria uma amostra do sangue e isolaria uma célula aleatoriamente que expressasse o gene da beta globina. Posteriormente, para sequenciar o gene da beta globina deveríamos através da técnica de PCR (com introdução dos primers do respectivo gene) proceder à amplificação para encontrar a sequência da beta-globina. Para sequenciar o mRNA é necessária a transcriptase reversa que vai actuar permitindo-nos obter cDNA que após a introdução dos primers adequados nos permite efectuar a sequenciação por RT-PCR.

Considere os resultados da sequenciação discutida no Caso de Estudo 1.

Que aspecto esperaria encontrar no electroferograma na região variável de cada indivíduo? Devido às mutações nas posições 462 da mãe(T->A) e no nucleótido 732 do pai(T->G), esperaria encontrar: Na mae, uma sobreposição de vermelho e verde devido à mutação na posição 462(T->A)e um pico vermelho na posição 732. No pai, sobreposição de vermelho e preto devido à mutação no nucleótido 732 e um pico vermelho ao nível da posição 462. Na Maria provavelmente poderíamos verificar sobreposições de vermelho e verde na posição 462 e sobreposições de vermelho e preto no nucleótido 732. Estas mutações provem da mãe e do pai respectivamente.

Se tivesse apenas acesso aos resultados da sequenciação da Maria, seria capaz de definir o seu genótipo com rigor? Justifique. Os resultados da sequenciação da Maria em isolado não nos permitem definir o seu genótipo com rigor uma vez que podem haver mutações em diferentes alelos em simultâneo e portanto é necessária uma avaliação global para se poder definir a patologia.

Com base na sequência do gene da beta-globina disponível na última TP e as técnicas de análise de sequências que tem vindo a aprender identifique as regiões do gene em que se localizam as alterações pontuais encontradas. Recorrendo ao BLAST para fazer o alinhamento da sequência do gene e mRNA obtido ficamos a saber que a mutação 462 corresponde a uma região codificante do genoma (tendo como consequência uma proteína truncada) enquanto que a mutação no nucleótido732 corresponde a uma zona reguladora do splicing, contida na porção não codificante do genoma.



[edit] Para pensar Se a sequenciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?


O método de Maxam&Gilbert permite clivar moléculas radioactivas de DNA ao nivel de diferentes nucleótidos. Este método inicia-se na clivagem diferencial dos nucleótidos por quatro reacções diferentes usando quimicos diferentes especificos para as bases obtendo segmentos de DNA clivados. Cada segmento termina numa base diferente sendo por isso possivel deduzir a sequência através da análise do perfil de bandas radioactivas na electroforese. Este método não necessita do conhecimento prévio de partes da sequência uma vez que não recorre a primers apenas a reacções de clivagem permitindo efectuar as primeiras sequenciações.


Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?


Clivagem do genoma em sequências menores (a sequenciação tem sempre um limite em número de pares de bases) seguindo-se uma clonagem destas sequências em BACs (cromossomas bacterianos artificiais) que são por fim transferidos para células de um vector celular como a E. coli. Desta forma é possível criar uma biblioteca genómica util para sequenciar posteriormente cada segmento.




Personal tools