User:Iolanda S. O. Santos/Notebook/Caderno de Apontamentos/2010/03/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Next entry

Exercício TP1

  • Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos? DNA, DNA mitocondrial e DNA recombinante que têm incorporadas as bases A, T, C e G. RNA, mRNA e tRNA que têm incorporadas as bases A, U, C e G.

Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real. 5' -> 3'; 2 pontes de H entre A (adenina) e T (timina) e 3 pontes de H entre C(citosina) e G(guanina).

Poderá esta sequência conter um gene? Justifique a sua resposta. Para conter um gene terá de existir o codão de iniciação ATG (metionina) e um dos três codões stop (UAA, TAG e TGA).

codão de iniciação ATG (metionina = codão de iniciação: AUG 5' -> 3' corresponde a UAC 3' ->5' no RNA, que por sua vez corresponde a ATG 5' ->3' no DNA). Na sequência acima encontram-se 3 ATG se lermos no sentido de cima para baixo, caso contrário encontramos 2 ATG (linha de baixo).

Indique o resultado da transcrição desta sequência.

UUGACACUACCGAGGUGUACUAUUUUUACCCGAGUCGCUAAUUUUUGCCGCAAGGUGCUAAGCCGCGAGG AAAGCGAGGCUGAACAGGCAGUCGCCCGUCCACAGGUGACGGUGAUCCCGCGUGAGCAGCAUGCUAUUUC CCGCAAAGAUAUCAGUGAAAAUGCCCUGAAGGUAAUGUACAGGCUCAAUAAAGCGGGAUACGAAGCCUGG

É possível prever que proteína se encontra codificada numa sequência nucleotídica? Como?

Se tivermos a sequencia quer de DNA ou a referente à transcrição, utilizando uma tabela que estabeleça a conexão entre as bases azotadas do RNA e os aa ou utilizando a tabela inversa (DNA -> aa) conseguimos saber quais os aa traduzidos e, por fim, saber qual a proteína em questão. Teremos de ter o codão de iniciação e um dos codões stop, caso contrário poderemos ter uma open frame - fracção de um gene.

A sequência apresentada codifica alguma proteína? Consulte aqui o código genético

5'3' Frame 1 L T L P R C T I F T R V A N F C R K V L S R E E S E A E Q A V A R P Q V T V I P R E Q H A I S R K D I S E N A L K V Met Y R L N K A G Y E A W

5'3' Frame 2 Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P

5'3' Frame 3 D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L

3'5' Frame 1 P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q

3'5' Frame 2 Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V

3'5' Frame 3 R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S

5'3' frame 1 - não há codão stop - fracção de proteína? 3'5' frame 1 - poderá corresponder à seguinte proteína - Met L L T R D H R H L W T G D C L F S L A F L A A Stop 3'5' frame 2 - sem codões stop e de iniciação - poderá ou não corresponder a uma proteína


Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana? GUG, UUG, CUG e AUU estão documentados como codões de iniciação. De uma maneira geral, codões de iniciação do tipo NUG.

Como poderia saber de que organismo provém esta sequência? Usar o BLAST.



Personal tools