User:Joana Vieira Fernandes/Notebook/Joana Fernandes/2010/03/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Next entry


Exercício

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

  • Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?
  1. DNA - DNA complementar (cDNA), genes, promotores.
  2. RNA - RNA de transporte (tRNA), RNA ribossomal (rRNA), RNA mensageiro (mRNA).

No DNA existe a base timina, enquanto que no RNA a timina está ausente, sendo substituída por uracilo. Tanto no DNA como no RNA, a sequência da molécula está representada no sentido 5' - 3'.


  • Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.

Podemos representar por tripletos.


  • Poderá esta sequência conter um gene? Justifique a sua resposta.

Sim, se a sequência contiver o codão de iniciação e o codão de finalização.


  • Indique o resultado da transcrição desta sequência.

UUGACACUACCGAGGUGUACUAUUUUUACCCGAGUCGCUAAUUUUUGCCGCAAGGUGCUAAGCCGCGAGG AAAGCGAGGCUGAACAGGCAGUCGCCCGUCCACAGGUGACGGUGAUCCCGCGUGAGCAGCAUGCUAUUUC CCGCAAAGAUAUCAGUGAAAAUGCCCUGAAGGUAAUGUACAGGCUCAAUAAAGCGGGAUACGAAGCCUGG


  • É possível prever que proteína se encontra codificada numa sequência nucleotídica?

Como?

Sim, através dos tripletos.


  • A sequência apresentada codifica alguma proteína?
  1. 5'3' Frame 1

L T L P R C T I F T R V A N F C R K V L S R E E S E A E Q A V A R P Q V T V I P R E Q H A I S R K D I S E N A L K V Met Y R L N K A G Y E A W

  1. 5'3' Frame 2

Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P

  1. 5'3' Frame 3

D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L

  1. 3'5' Frame 1

P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q

  1. 3'5' Frame 2

Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V

  1. 3'5' Frame 3

R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S

De todas as hipóteses, as únicas que apresentam um quadro de leitura não interrompido por codões stop são a Frame 1 de 5' - 3' e a Frame 2 de 3' - 5' , ou seja, podem corresponder a uma parte de uma sequência codificante de uma proteína.


Consulte aqui o código genético

  • Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?

A leitura do código genético standard é diferente da leitura do código genético da variante bacteriana. Desta forma, cosoante os códigos genéticos, um mesmo tripleto pode codificar mais do que um aminoácido diferente, ou mesmo um aminoácido e um codão stop.


  • Como poderia saber de que organismo provém esta sequência?

Comparava esta sequência com todas as sequências existentes na base de dados, disponivel no ncbi, utilizando o BLAST.



Personal tools