User:Mbennie/Notebook/Oligos/FLAG Tag-F

From OpenWetWare

Jump to: navigation, search

Sequence: gtttcttcgaattcgcggccgcttctagaggtgattacaaggatgacgatgacaag

Binding site: 25 bp

Predicted Tm: 54.9C

Received: 8/16/2007

  • Resuspended at 50uM with 340.4ul of TE
Personal tools