User:Mbennie/Notebook/Oligos/Mut Pst1a-R

From OpenWetWare

Jump to: navigation, search

Sequence: gctcttcaggcagatgacaggcggctgtaacg

Binding site: 21 bp

Predicted Tm: 56.6C

Received: 7/31/2007

  • Resuspended at 50uM with 392ul of TE
Personal tools