User:Olivia Richter/Notebook/Biology 210 at AU
Zebrafish Exposed to Caffeine 3/23/16 The purpose of this experiment was to observe the effects that a chemical variable, in this case caffeine, have on embryogenesis in zebrafish. Our observations are as follows: The Biology 210 Lab Manual was used for initial guidance in planning this experiment. Caffeine was decided upon as a variable to observe zebrafish development. A 24 welled dish, with six rows of four wells each was obtained. In the first two rows, 20mL of Deer Park water treated with methylene blue was placed, about 3.4 mL per well. The methylene blue was used as an anti-fungal. In the wells of the next two rows, a concentration of deer park water with 10mg/L of caffeine was placed, about 3.4 mL per well. In the final two rows of wells, a concentration of deer park water with 40mg/L of caffeine was placed, again with about 3.4 mL per well. Zebrafish embryos 18-36 hours post fertilization were provided at the beginning of this experiment. Using a dropper, the eggs were transferred into the wells, taking care to minimize the amount of water transferred with the animals. Two healthy, translucent zebrafish embryos were placed in each well, so that there were 48 total embryos, with 16 in each condition (the control, 10 mg/L caffeine, and 40 mg/L caffeine). Observation Schedule: The zebrafish embryos were observed daily over a period of two weeks, not including weekends. A list of variables to make specific observations on was derived. Motility of the zebrafish, length, heart rate, mortality, and general characteristics were specifically observed. A dissecting scope was used every day to make observations of general characteristics and mortality. When the zebrafish hatched from their protective embryos, a compound microscope and depression slide was used to take length and heart rate measurements of a representative embryo for each group; the control, 10 mg/L caffeine, and 40 mg/L caffeine. When using the compound microscope, a few drops of sample with the organism was placed in the depression slide and the 4X objective was used. For general characteristics, observations were made on traits including body and tail pigmentation, eyes and eye movement, fin development, mouth development, and general movement. All of these observations were recorded on a document. Photographs of the zebrafish were taken under the dissecting scope. If water levels looked low or there was decaying matter in the water, the matter was removed with a dropper and more solution was added from stores of the control water, the 10 mg/L caffeine concentration, and the 40 mg/L caffeine concentration. Starting after day 7, two drops of paramecium were fed to each well. Also on day 7, three zebrafish from the control, 2 zebrafish from the 10 mg/L concentration, and three zebrafish from the 40 mg/L concentration were taken for fixation. A dropper was used to get the zebrafish into a tube containing tricaine solution. Paraformaldehyde was then added. The fixed zebrafish were dead but the paraformaldehyde would ensure they would not decay, so that the zebrafish could be studied. On March 1, 14 days since the experiment began, final observations were made and recorded of the remaining zebrafish. Those fish that had bodies intact and free from mold were fixed with tricaine and paraformaldehyde. All decaying and moldy fish were disposed of and the dish was cleaned.
Results:
This experiment provided an effective way of studying the process of embryogenesis and the critical importance of early development. The results collected support the hypothesis that exposure to caffeine hinders development in zebrafish embryos. The control zebrafish were able to grow the longest and survive to full development, whereas the 10 mg/L and 40 mg/L zebrafish faced different challenges. The 10 mg/L zebrafish faced high mortality rates. It is possible there was contamination of the water they lived in that contributed to their high mortality. They were shorter on average than the control fish and did not reach maturation. The 40 mg/L zebrafish were developmentally stagnated, displaying the most obvious morphological differences from the healthy zebrafish, including eye movement, asymmetry, and frantic motility that tapered into barely any movement towards the end of the experiment. These results can be used to make hypotheses on the effects of human embryo exposure to caffeine. Because it is immoral to experiment on developing human embryos, experiments like this one with zebrafish are helpful. Translating the results received in this experiment, it would make sense to hypothesize that exposing developing human embryos to caffeine could lead to developmental stagnation and problems in the maturation of the embryo. Thus it is wise not to consume caffeine while pregnant. Further experimentation could be done on other organisms’ embryos reaction to caffeine exposure. Also, smaller incrementations of caffeine exposures could be tested on zebrafish embryos to see more clearly how much caffeine it takes until developmental problems begin to occur. The process of embryogenesis is extremely critical in the life of an organism. Development at this stage is key to the success of the organism throughout its whole life. It is important to perform experiments like this one to determine possible sources of problems in embryo development.
-OR
Vertebrates and Niches 3/14/2016 The purpose of this section of our Vertebrate lab was to be able to connect the dots between the vertebrates that inhabit our transect and the rest of the organisms we have studied thus far.
Methods: A list of five vertebrates that could possibly inhabit our transect was created, and the classification of each was determined. A food web based on all the groups of organisms observed in transect 2 was drawn. Finally, a short description of how these organisms represent the ecological concepts of "community", "carrying capacity", and "trophic levels" was written.
5 Vertebrates that might inhabit Transect 2 1. Northern Cardinal (cardinalis cardinalis) Phylum: Chordata Class: Aves Order: Passeriformes Family: Cardinalidae Genus: Cardinalis Species: Cardinalis Characteristics of the transect that would benefit cardinals: Shrub coverage and trees to provide shelter, availability of seeds and insects for foraging
2. American Robins (Turdus migratorious) Phylum: Chordata Class: Aves Order: Passeriformes Family: Turdidae Genus: Turdus Species: Migratorious Characteristics of the transect that would benefit American Robins: They eat earthworms which are available in the transect, they commonly live in decidious woodlands, in Winter they gather in trees to roost
3. White-tailed deer (Ococoileus Virginianus) Phylum: Chordata Class: Mammalia Order: Artiodactyla Family: Cervidae Genus: Odocoileus Species: Odocoileus virginianus Characteristics of the transect that would benefit White-tailed deer: They eat most available plant foods (leaves, twigs, grass, and some fungi), they live in wooded areas
4. Eastern Grey Squirrel (Sciurus Carolinensis) Phylum: Chordata Class: Mammalia Order: Rodentia Family: Sciuridae Genus: Sciurus Species: Sciurus carolinensis Characteristics of the transect that would benefit Eastern Grey Squirrel: They prefer wooded areas, use trees for nests, eat nuts, seeds, flowers and buds of various trees, and they drink standing water like the stream that runs through Transect 2
5. New England Cottontail rabbit (Sylvilagus transitional ) Phylum: Chordata Class: Mammalia Order: Lagomorpha Family: Leporidae Genus: Sylvilagus Species: Sylvilagus transitionalis Characteristics of the transect that would benefit New England Cottontail: They require a sheltering environment which is available in transect 2, they inhabit areas with dense vegetation, and feed on grasses/clover in summer and twigs in buds in winter which are all available in the transect
Food web based on all the groups of organisms observed in transect 2:
These organisms represent the concept of community by successfully co-inhabiting transect 2. They interact in ways which allow all of them to live and reproduce. The transect is kept at carrying capacity in order for all of these organisms to be successful. If the population of robins were to grow larger, the earthworm population would be diminished, affecting the entire food web. Carrying capacity is maintained so that there remains enough resources for all organisms to coexist. There are different trophic levels in transect 2. The bottom trophic level consists of organisms like dead animals and plants. They provide the base of the food chain. Next are those that feed on plants and dead animals, like bacteria, fungi, and invertebrates like earthworms. The next trophic level consists of those animals like robins and millipedes that feed on earthworms and bacteria. Following that are the carnivorous species like foxes and hawks that eat animals like robins and deer. The trophic levels are kept in equilibrium because as we move down the food chain, the organisms tend to get smaller. Because there is such a large population of bacteria, millipedes have much available to them. Millipedes are much larger than bacteria so there are less of them, but still enough to feed a bird like a robin. Birds are even bigger, and a hawk is able to eat them because it needs a larger source of food, but does not need to eat nearly as many robins as a millipede needs to eat bacteria.
Conclusion: Through this study, I was able to learn the ways in which vertebrates fit into the ecosystem of transect 2. I created a food web that depicts the ways all the organisms of the transects are connected.
-OR
Results of the 16s Sequencing 3/2/2016
The purpose of the 16s sequencing was to identify the species of bacteria we had in our transect that we had studied on the Tet+ agar plate and the nutrient agar plate. We chose one bacteria from each of the two plates that had the most complete characterization, and used primers and PCR amplify the 16s rRNA gene. We chose this gene because the gene sequence is diverse and specific to each species. Unfortunately, we did not get conclusive results when we ran the gel. In order to note what species we could have had, I will give the results of a previous lab group that was also studying transect 2. I am using the results from last spring's Section 3 user Kervin D Hilaire.
After sequencing the 16s gene, this is the resulting gene sequence:
CTCNTGTNACGGTNNNNNACTTCAGGTACCCCAGACTTCCATGGCTTGACGGGCG GTGTGTACAAGGCCCGGGAACGTATTCACCGCGCCATGGCTGATGCGCGATTACTAGCGATTCCAGCTTCATAGAGTCGA GTTGCAGACTCCAATCCGAACTGAGACCGGCTTTCGAGATTCGCATCACATCGCTGTGTAGCTGCCCTCTGTACCGGCCA TTGTATTACGTGTGTGGCCCAAGGCGTAAGGGCCGTGATGATTTGACGTCATCCCCACCTTCCTCTCTACTTGCGTAGGC AGTCTCACTAGAGTCCCCAACTTAATGATGGCAACTAGTGACAGGGGTTGCGCTCGTTGCAGGACTTAACCTAACACCTC ACGGCACGAGCTGACGACAACCATGCAGCACCTTGAAAAATGTCCGAAGAAAAGTCTATTTCTAAACCTGTCATTTCCCA TTTAAGCCTTGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATAATCCACCGCTTGTGCGGGCCCCCGTCAATTCC TTTGAGTTTCAGACTTGCGTCCGTACTCCCCAGGTGGCTAACTTATCACTTTCGCTTAGTCTCTGAATCCGAAAACCCAA AAACGAGTTAGCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTCGCTCCCCACGCTTTCGTCCATCAGCGT CAGTTGTTGCTTAGTAACCTGCCTTCGCAATTGGTGTTCTAAGTAATATCTATGCATTTCACCGCTACACTACTTATTCC AGCTACTTCAACAACACTCAAGACTTGCAGTATCAATGGCAGTTTCACAGTTAAGCTGTGAGATTTCACCACTGACTTAC AAATCCGCCTACGGACCCTTTAAACCCAATAAATCCCGGATAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG GGAGTTAGCNNNGCTTANTCGTATAGTACCTTCAGCTAGATACACGTANNTNGGTTTATCCCTATACAAAGAAGTTTA
This sequence determines that the organism it came from is Chryseobacterium jejeunse. This bacteria is aerobic, Gram-negative, non-motile , yellow-pigmented and straight rod-shaped.
Here is a photo of the gel electrophoresis process for this bacteria:
Conclusion: It was unfortunate that our gene sequencing did not work, but very interesting to see how it worked in a previous lab. Using this information, we could successfully identify a bacteria found in Transect 2 as Chryseobacterium jejeunse.
-OR
Invertebrates 2/24/26
The purpose of this lab was to use the dichotomous key to identify different species of invertebrates from our transect, to be able to give examples of which type of germ tissue gives rise to which organ types/systems, to describe different types of motility and digestion in flatworms, roundworms, and annelids, and to know the difference between deuterostomes and protostomes.
We constructed the Burlese Funnel by putting 25 mL of a 50/50 ethanol and water solution into a conical tube. A piece of screening material was taped onto the bottom of the funnel and then the leaf litter from the transect was placed inside. The funnel and conical tubes were secured together using more tape and then a layer of parafilm to prevent the ethanol from evaporating. The funnel was then placed under a 4 watt lamp and everything was covered with foil for one week.
Below is a chart identifying five different species of invertebrates from our Berlese Funnel, which we identified using the dichotomous key.
The size range of the invertebrates we found is .5 millimeter to 5 millimeters. The largest organism was an arthropod, and we only found one in the Berlese Funnel. The smallest organism was also an arthropod, and we found two of them. We only observed insects of all the arthropods we saw in our Berlese Funnel, leading us to hypothesize that the insects are the most common invertebrates in Transect 2.
This is a photograph of the invertebrates that fell from our Berlese Funnel:
The following are photographs of the five arthropods we observed:
Conclusion: We were successfully able to use the Berlese Funnel to observe different invertebrates from Transect 2. We used the Dichotomous Key to identify these arthropods, and studied their motility and digestion.
-OR
Plantae and Fungi 2/17/16 The purpose of this lab was to give examples of the unique characteristics that plants have evolved, to describe the definitive characteristics of fungi and explain how they are different from plants, to list the distinctions between angiosperms and bryophytes, to understand the alternation of generations, and to identify the structure and function of the reproductive parts of a flower.
We collected 5 different plants from our transect, Transect 2. We also collected a leaf litter to use for the Berlese Funnel that was a part of our next lab. I took a photograph of the tree we took a leaf from as one of our plants:
The following table provides information about all 5 of the plants we collected. It includes the location we found them, their size and description, their vascularization, their specialized structures, and their methods of reproduction.
Unfortunately, we did not collect any seeds from our transect.
Conclusion: We were successfully able to identify certain morphological structures on each of the plants. We were able to determine of they were monocot or dicot, angiosperm/gymnosperm or bryophytes, and to determine what methods of reproduction each plant used.
-OR
Microbiology 2/10/16
The purpose of this lab was to quantify the number of bacteria in our Hay Infusion and to observe the diversity in the Infusion. We also wanted to observe the diversity of morphological characteristics of the bacteria from our Hay Infusion, and to test for naturally occurring antibiotic resistance in bacteria. We wanted to identify bacteria based on colony morphology, motility, cell shape and a gram stain. Finally, we wanted to use PCR and DNA sequencing to verify our identification of the bacterial species.
Before we began we took one last observation of our Hay Infusion. One third of the water had evaporated. All plant and soil material had greatly condensed to the bottom of the jar. The film on the water surface we had observed had grown much thicker. The smell was an intense mixture of rotten food and dirt. We hypothesized that the change in appearance and smell of the infusion from week to week is due to the microorganisms consuming the nutrients in the jar.
Table 1: The Results of our 100-Fold Serial Dilution
This table led us to believe that the Tet + agar plates resulted in much less bacteria colonies. This is likely because the antibiotic killed much of the organisms. On the agar plates without Tet +, bacteria was able to grow freely without any danger from antibiotics, explaining why we saw a much greater number/size of colonies on those plates.
Here is an image of our agar plates. The plates with Tet + are on the bottom of the image, and those without Tet + are on the top.
Tetracycline antibiotics work by inhibiting protein synthesizers. They inhibit the binding of aminoacyl-tRNA to the mRNA ribosome complex (Wikipedia 2015).
The following table gives a description of our observations using different techniques to identify the bacteria from our transect. We observed colony size, shape, and color, we looked at the motility and the appearance of the bacteria using the 40x lens on a microscope, and we used a gram stain to test antibiotic resistance.
Table 2: Bacteria Characterization
Conclusion: Through our many tests in this lab we are able to conclude that Tetracyline was the reason there was less biological diversity in the organisms on the agar plates with Tet +. However, the organisms we did observe on these plates had developed antibiotic resistance to Tet + and were therefore still able to thrive in its presence.
-OR
Exercise III Protists and Algae 2/3/16
In this lab, we learned how to use a Dichotomous Key to identify the organisms on wet mounts made from out hay infusion and to learn common characteristics of algae and protists. We made wet mounts from two niches in our hay infusion; from the top of the jar and from the bottom of the jar. After this, we prepared and plated serial dilutions for the following week so that we could observe prokaryotic organisms and possibly some fungi from our hay infusion.
Taking a sample from the niche at the TOP of our hay infusion, we made a wet mount and observed it under the microscope. Here is a drawing of one of the organisms we saw:
Using the dichotomous key, we believe this organism to be Blepharisma. It was non-motile. Blepharisma are protists found in fresh and salt water. They do not photosynthesize, but ingest food from their environment. In the top niche, we also observed euglena and chlamydomonas.
Taking a sample from the niche at the BOTTOM of our hay infusion, we made a wet mount and observed it under the microscope. Here is a drawing of an organism we saw:
Using the dichotomous key, we believe this organism to be Paramecium. It was motile. Paramecium are protozoans often found in fresh water. In the bottom niche, we also observed didinium and chlamydomonas.
How do paramecium meet all the needs of life? Paramecium can move, digest food, and reproduce. They are unicellular. Their cilia allows them to move. To eat, they ingest food into the cell mouth. Paramecium can reproduce both sexually and asexually. Asexual reproduction is more common. Under stressful situations they may reproduce sexually.
If the hay infusion were to "grow" for another two months, most likely we would observe that most of the microorganisms would have died or would be in a struggle to survive. Nutrients would be hard to come by inside the small jar, because most would have already been consumed. Selective pressures would favor organisms who can photosynthesize, because they would be able to gain nourishment from light instead of the dwindling nutrients inside the jar.
Diagram of the Serial Dilution (for next lab period):
Conclusions: We came out of this lab with an understanding of how to use a dichotomous key to identify algae and protists. In future experiments, it might be interesting to allow the hay infusion to keep growing and changing and observe which organisms survive and whether or not they are the photosynthetic organisms like we hypothesized.
-OR
Observing a Transect at AU 1/27/16
Aerial diagram of the transect:
List of Biotic and Abiotic Components:
Biotic- 1. Trees 2. Bushes 3. Squirrel
Abiotic- 1. Rocks 2. Water 3. Dead leaves
General description of the transect characteristics:
Transect 2 is located next to the amphitheater. It includes a stream and surrounding bushes, ferns, and trees. The stream runs directly down the middle of our transect. There is a path formed by stones down to the stream. There is a thick layer of dead leaves on the ground. Soil, rocks, and leaves are damp near the stream. The bushes, trees and shrubs are quite barren due to the freezing cold temperatures. There is an irragation pipe in the ground close to the edge of the transect on the amphitheater side of the stream. Inside the stream, there are many large rocks and wet soil. The stream was not heavily flowing on the day of our first lab, but following the blizzard this past weekend it is flowing quite heavily. As I walk past the transect on a daily basis, I often see brown and black squirrels inside it.
-OR
Observations of Hay Infusion Culture 1/20/16
Purpose: To observe a culture created from our transect on the AU campus. Materials: - Soil, leaves, plant matter, stream water, and small rocks from transect 2 - Clear jar - Water
Methods: We collected the materials from transect 2 in Lab 1, and followed the protocol to create the Hay Infusion. We then let the Hay Infusion sit until Lab 2, where we made our observations. Following this, we collected samples from two different niches of the jar, the top and the bottom. We created slides with the samples and observed them using a microscope. We drew pictures of any organisms we saw in the microscope.
Data and Observations:
Photos of Hay Infusion-
Our hay infusion smells very badly (like mold). The water has grown a bit murky, with a film of what appears like mold forming on top and some soil formations floating. Some brown dust has formed on the bottom of the jar. Everything else (leaves, twigs, pieces of bushes and plants) are floating in the jar.
Drawing from Niche 1 (Top of jar):
Observations: All organisms we saw are non-moving. Organisms are sparse. Using the dichotomous key, we concluded the specimen seen is Blepharisma.
Drawing from Niche 2 (Bottom of jar):
Observations: Many different organisms, moving very quickly. A range of sizes. All clear and colorless. Using the dichotomous key, we concluded that we saw paramecium, blepharisma, and chilomonas.
Choose one of the organisms and describe how this species meets all the needs of life as described on page 2 in the Freeman text: Paramecium
If we were to let the hay infusion grow for another two months, I would predict a range of organisms to thrive. I would think that it would be much easier to find organisms in the microscope, especially from the top niche. We would say much greater numbers of organisms and probably many we did not observe after just one week.
-OR
