User:Tk/Notebook/MF/2009/03/24

From OpenWetWare
< User:Tk‎ | Notebook‎ | MF‎ | 2009‎ | 03
Jump to navigationJump to search
Mesoplasma florum simplification <html><img src="/images/9/94/Report.png" border="0" /></html> Main Page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Recombination cassette construction

  • primers used for recombination experiments 4/15/03


  • These are primers for the flanking regions around the Sau3AI methylase and restriction enzyme genes
  • Mfl2I-up-F <prefix> TCCAAATAGTGTGGATAC 352951 - 352968
  • Mfl2I-up-R <speI site> aag aca tct atg ttt ttt tac 353389 - 353409
  • Mfl2I-dn-F <prefix> gag att att atg gca aaa g 356063 - 356081
  • Mfl2I-dn-R <speI site> aat atg agt aaa ttc ac 356763 - 356779


  • These are primers for the PheS gene
  • PheS-mf-F <prefix> CCAAATAACTCTGTTATTGG 460253 - 460272
  • PheS-mf-R <speI site> at gtt cta cct act ctc c 459091 - 459108
  • PheS-mf-F2 <prefix> ctc tgt tat tgg tat agt ta 460245 - 460264




Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Tk/Notebook/MF/2009/03/24&oldid=296678"