IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/22

From OpenWetWare

< IGEM:UW | 2008 | Notebook | iGEM UW Team | 2008 | 05(Difference between revisions)
Jump to: navigation, search
Current revision (04:24, 12 June 2008) (view source)
 
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
-
1. Design of starters for sequencing something we want from pMPM-T5
+
1. Design of primers for sequencing something we want from pMPM-T5
-
Starters:
+
Primers:
pMPMT5seqF  CTACTGTTTCTCCATACCCG
pMPMT5seqF  CTACTGTTTCTCCATACCCG

Current revision

University of Warsaw iGEM Team 2008 Main project page
Previous entry      Next entry

1. Design of primers for sequencing something we want from pMPM-T5

Primers:

pMPMT5seqF CTACTGTTTCTCCATACCCG

pMPMT5seqR GAAAATCTTCTCTCATCCGC

AIDseqP GCTTCGGCGCATCCTTTTG


Personal tools