IGEM:UW/2008/Notebook/iGEM UW Team/2008/06/05

From OpenWetWare

< IGEM:UW | 2008 | Notebook | iGEM UW Team | 2008 | 06(Difference between revisions)
Jump to: navigation, search
Current revision (15:35, 12 June 2008) (view source)
 
Line 12: Line 12:
Primers:
Primers:
-
pZCseqL  CTTGACCCGCAGTTGCAAAC
+
 
-
pZCseqP  CCCAACTGATCTTCAGCATC
+
pZCseqL  CTTGACCCGCAGTTGCAAAC
 +
 
 +
pZCseqP  CCCAACTGATCTTCAGCATC
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->

Current revision

University of Warsaw iGEM Team 2008 Main project page
Previous entry      Next entry


1. Transformants E.coli TOP10 with pZC320 (liquid LB)

2. Design of primers for sequencing β-galactosidase from pZC320

Primers:

pZCseqL  CTTGACCCGCAGTTGCAAAC
pZCseqP  CCCAACTGATCTTCAGCATC


Personal tools