User:Anugraha Raman/Notebook/iGEM 2010/2010/06/23: Difference between revisions
From OpenWetWare
No edit summary |
|||
Line 13: | Line 13: | ||
**Go to the [[http://openwetware.org/wiki/IGEM:Harvard/2010/Team_Allergy| amiRNA section]] for our primers for this multi step PCR or see chart below: | **Go to the [[http://openwetware.org/wiki/IGEM:Harvard/2010/Team_Allergy| amiRNA section]] for our primers for this multi step PCR or see chart below: | ||
{| class="wikitable" border =" | |||
{| class="wikitable" border ="3px solid black" | |||
|- | |- | ||
| | |'''Description''' | ||
| | |'''Forward (A)''' | ||
| | |'''Reverse (B)''' | ||
|- | |- | ||
|biobrick RS300 | |'''biobrick RS300''' | ||
|''CCTTGAATTCGCGGCCGCATCTAGA'' CCCACAAACACACGCTCGGA | |''CCTTGAATTCGCGGCCGCATCTAGA'' CCCACAAACACACGCTCGGA | ||
|''AAGGCTGCAGCGGCCGCTACTAGT'' CCCCATGGCGATGCCTTAAA | |''AAGGCTGCAGCGGCCGCTACTAGT'' CCCCATGGCGATGCCTTAAA | ||
Line 26: | Line 27: | ||
{| class="wikitable" border =" | {| class="wikitable" border ="3px solid black" | ||
|- | |- | ||
| | |'''Description''' | ||
| | |'''Primer 1 (mir sense)''' | ||
| | |'''Primer 2 (mir antisense)''' | ||
| | |'''Primer 3 (mir* sense)''' | ||
| | |'''Primer 4 (mir* antisense)''' | ||
|- | |- | ||
|[http://wmd3.weigelworld.org/cgi-bin/webapp.cgi?page=Designer&project=stdwmd&rm=show_results&id=7205 GFP] | |[http://wmd3.weigelworld.org/cgi-bin/webapp.cgi?page=Designer&project=stdwmd&rm=show_results&id=7205 GFP] |
Revision as of 11:54, 23 June 2010
Project name | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | ||||||||||||||||||||||||||
Wednesday June 23, 2010amiRNA
|