User:Elaine Marie Robbins/Notebook/CHEM-496/2011/10/12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
(3 intermediate revisions by the same user not shown)
Line 11: Line 11:
<b>Conductivity of AuNP II</b>
<b>Conductivity of AuNP II</b>


To repeat the experiment on [http://openwetware.org/wiki/User:Elaine_Marie_Robbins/Notebook/CHEM-496/2011/10/11 10/11/11] and make electrodes to test conductivity of MBP protein fibers containing AuNPs using a four point probe.
To repeat the experiment on [http://openwetware.org/wiki/User:Elaine_Marie_Robbins/Notebook/CHEM-496/2011/10/11 10/11/11] and make electrodes to test the conductivity of MBP protein fibers containing AuNPs using a four point probe.




Line 26: Line 26:
# Repeat with 3 more wires/foils.
# Repeat with 3 more wires/foils.
# Glue wires/foils to Teflon plate with Instant Krazy Glue.
# Glue wires/foils to Teflon plate with Instant Krazy Glue.
# When dry, plate AuNP-containing protein fibers onto the Teflon across the Pd foils.
# Allow the solvent to evaporate overnight.


<b>DNA Sequencing</b>
<b>DNA Sequencing</b>
Line 59: Line 61:
==Notes==
==Notes==


<b>Conductivity of AuNP II</b>
Electrodes made on [[User:Elaine_Marie_Robbins/Notebook/CHEM-496/2011/10/11|10/11/11]] were not functional because the conductive epoxy used did not successfully glue the Pd foil and wire to the Teflon surface.
<b>DNA Sequencing</b>
It was determined that the primers used to create the mutation in the GFP DNA sequence actually coded for the wild type GFP sequence. Thus, no mutation was possible.


[[Category:Course]]
[[Category:Course]]

Revision as of 10:38, 1 November 2011

Conductivity of AuNP II, DNA Sequencing <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Objective

Conductivity of AuNP II

To repeat the experiment on 10/11/11 and make electrodes to test the conductivity of MBP protein fibers containing AuNPs using a four point probe.


DNA Sequencing

To compare the mutant GFP DNA sequence purified on 10/05/11 to the wild type GFP DNA sequence to determine if the mutation is present.

Description

Conductivity of AuNP II

  1. Glue Pd wire onto Pd foil using conductive epoxy.
  2. Heat with heat gun until epoxy dries.
  3. Repeat with 3 more wires/foils.
  4. Glue wires/foils to Teflon plate with Instant Krazy Glue.
  5. When dry, plate AuNP-containing protein fibers onto the Teflon across the Pd foils.
  6. Allow the solvent to evaporate overnight.

DNA Sequencing

  1. Compare the obtained DNA sequence of GFP to the wild type DNA sequence from Invitrogen

Data

Conductivity of AuNP II

Areas of Pd foil used, from left to right: 35.20 mm2, 41.16 mm2, 40.18 mm2, 38.64 mm2.


DNA Sequencing

Obtained DNA sequence of mutant GFP, mutation site bold and underlined:

NNNNNNNNNNNTTTGTTNNACTTTAAGAAGGAGNTATACATATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCAT GACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGATCGATGGGGATCCGAATTCGCCACCATGGTGAGC AAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCG GCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC CCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCC ATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGG GCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAA CTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAG GACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACC TGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGAT CACTCTCGGCATGGACGAGCTGTACAAGTAACTCGAGAAGCTTGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCT GCTGCCACCGCTGANCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACT

The DNA sequence at the mutation site is identical to the wild type sequence. Therefore, the DNA was not mutated as intended.

Notes

Conductivity of AuNP II

Electrodes made on 10/11/11 were not functional because the conductive epoxy used did not successfully glue the Pd foil and wire to the Teflon surface.


DNA Sequencing

It was determined that the primers used to create the mutation in the GFP DNA sequence actually coded for the wild type GFP sequence. Thus, no mutation was possible.