User:Tk/Notebook/MF/2008/07/31: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(Autocreate 2008/07/31 Entry for User:Tk/Notebook/MF) |
(→Title) |
||
| Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
== | ==Transposon insertion event at 523000-525000== | ||
* | |||
A pseudogene and inactive IS3/IS1138 transposon is at 523336-524543 | |||
* IRL: 523336-523356 | |||
* IRR: 524523-524543 | |||
* The sequence of the transposon insertion site is: ataaactgggaaaaataaaat | |||
* Transposase gene has three frame shifts and multiple stop codons (both TAA and TAG) | |||
* Approximate locations: | |||
** 523660-524485 | |||
** Frame 1: 523660-523993 | |||
** Frame 3: 523969-524161 | |||
** Frame 2: 524170-524260 | |||
** Frame 3: 524275-524485 | |||
Revision as of 13:22, 31 July 2008
 Mesoplasma florum simplification
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main Page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Transposon insertion event at 523000-525000A pseudogene and inactive IS3/IS1138 transposon is at 523336-524543
| |
