BME100 f2017:Group11 W1030 L4

BME 100 Fall 2017	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name:Teleah Hancer Name: zoe marmitt Name:Jose Role(s) Name: Una Name: student Role(s) Name: student Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR​ ​reaction​ ​mix,​ ​8​ ​tubes,​ ​50​ ​μL​ ​each:​ ​Mix​ ​contains​ ​Taq​ ​DNA​ ​polymerase,​ ​MgCl​2​,​ ​and​ ​dNTP’s DNA/​ ​primer​ ​mix,​ ​8​ ​tubes,​ ​50​ ​μL​ ​each:​ ​Each​ ​mix​ ​contains​ ​a​ ​different​ ​template​ ​DNA.​ ​All​ ​tubes have​ ​the​ ​same​ ​forward​ ​primer​ ​and​ ​reverse​ ​primer A strip of empty PCR tubes Disposable pipette tips Cup for discarded tips Micropipettor Open PCR machine: shared by two group PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G11 + Positive control none G11 - Negative control none G11 1-1 Patient 1, replicate 1 43374 G11 1-2 Patient 1, replicate 2 43374 G11 1-3 Patient 1, replicate 3 43374 G11 2-1 Patient 2, replicate 1 37706 G11 2-2 Patient 2, replicate 2 37706 G11 2-3 Patient 2, replicate 3 37706 DNA Sample Set-up Procedure Put on PPE Using a micropipettor with a clean pipette tip, extract 50​ ​μL​ of DNA/primer mix of patient 43374 into G11 1-1 tube get a new pipette tip and properly dispose of the used one Add 50​ ​μL​ the PCR reaction mix into that same G11 1-1 tube Use the Open PCR machine Repeat this procure 2 more time using patient 43374 DNA/primer and coordinating test tubes(G11 1-2 test tube for the second trial, G11 1-3 test tube for the third trial) Repeat same procedure 3 more time using patient 37706 DNA/primer and coordinating test tubes(G11 2-1 for the first trial , G11 2-2 for the second trial ,G11 2-3 for the third trial) OpenPCR program HEATED LID: 100°C INITAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds Anneal at 57°C for 30 seconds Extend at 72°C for 39 seconds FINAL STEP: 72°C FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology Q1. What is the function of each component of a PCR reaction? Template DNA: This is the specific DNA sequence that is trying to be copied Primers These attach to sites on the DNA strands that are at either end of the segment that are being copied Taq Polymerase This reads the DNA code and then attaches matching nucleotides to create DNA copies Deoxyribonucleotides (dNTP's) These are the single units of the bases A, T, G, and C, which are the building blocks for the new DNA strands Q2. What happens to the components (listed above) during each step of thermal cycling? INITIAL STEP: 95°C for 2 minutes: The template DNA starts to uncoil. Denature at 95°C for 30 seconds: The double helix separates, forming two single DNA strands. Anneal at 57°C for 30 seconds: Primers jump in and crowd the DNA, blocking it from going back into the double helix. The primers then attach to the single strands. Extend at 72°C for 30 seconds: The DNA polymerase are activated at this temperature. FINAL STEP: 72°C for 2 minutes: Once they activate, they attach to the primers and start to add nucleotides to the single stranded DNA FINAL HOLD: 4°C: The reaction is basically solidified, making it possible for no deterioration to occur Q3. DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below? Adenine(A): Thymine (T) Thymine(T): Adenine (A) Cytosine(C): Guanine (G) Guanine(G): Cytosine (C) Q4. During which two steps of thermal cycling does base-pairing occur? Explain your answers. Base-pairing occurs duirng the second and third steps of thermal cycling. The second step, denaturing (which happens at 95°C for 30 seconds) is where the double helix separates and forms two single DNA strands. Base-pairing also occurs during the third step, annealing (which happens at 57°C for 30 seconds) where the primers jump in and crowds the DNA, blocking it from going back to a double helix. Then the primers attach to the single strands. SNP Information & Primer Design Background: About the Disease SNP A nucleotide is a compound consisting of a nucleoside linked to a phosphate group. Nucleotides form the basic structural unit of nucleic acids such as DNA. Thymine, cytosine, adenine, guanine are the four nitrogenous bases in the DNA strand. Each type of the nitrogen bases will be bonded with their matching bond. (T to A and G to C) through hydrogen bonding which will in the end form the double helix of the DNA strand. Polymorphism on the other hand, in biology is the occurrence of different forms among members of a population, or in the cycle of life of an individual or an organism. However, in genetics polymorphism is the presence of the genetic variation within the population, in which natural selection can operate. The gene variation SNP (single nucleotide polymorphism), rs769452, is typically found in homo sapiens or humans, specifically in chromosome 19:44907853. The clinical significance that was listed for this SNP was that it is pathogenic, which means that it is linked to Alzheimer’s disease and subarachnoid hemorrhage in homo sapiens. Primer Design and Testing The APOE gene, provides instructions for making a protein called apolipoprotein E, which is what APOE stands for. This protein combines with lipids in the body to form something called lipoproteins which are responsible for bundling cholesterol and other fats and carrying them through the bloodstream. Maintaining normal levels of cholesterol is essential for the prevention of (cardiovascular diseases), including heart attack and stroke. The major alleles are called e2, e3, and e4. An allele is a variant form of a given gene. After looking at the Gene View on the illustrated and moving the cursor over the green flag that shows the SNP, rs769452, the numerical position of this SNP is 44907853. Non-disease forward primer: 5’ AGCGGCCAGCGCTGGGAACT 3’ Non-disease reverse primer: 5’ CAGGCCCCCCAAGACTTAGC 3’ Disease forward primer: 5’ AGCGGCCAGCGCTGGGAACC 3’ Disease reverse primer: 5’ CAGGCCCCCCAAGACTTAGC 3’