IGEM:Stanford/2009/Project Homeostasis/sequences/Blh

From OpenWetWare

Jump to: navigation, search

 

Home Team Project Parts Notebook Archives



RBS - Blh gene

Sequence: length= 889

gaattcgcggccgcttctagagaaagaggagaaatactagATGGGTCTGATGCTGATTGATTGGTGTGCACTG GCTCTGGTTGTTTTCATTGGCCTGCCGCACGGCGCGCTGGATGCTGCCATTTCTTTTTCTATGAT CTCTTCTGCAAAACGCATTGCTCGTCTGGCTGGTATTCTGCTGATCTATCTGCTGCTGGCGACCG CGTTCTTCCTGATCTGGTATCAGCTGCCAGCGTTTAGCCTGCTGATCTTCCTGCTGATCTCCATT ATCCACTTTGGTATGGCAGACTTCAACGCGTCCCCAAGCAAACTGAAATGGCCGCATATCATCGC CCACGGCGGTGTTGTTACTGTTTGGCTGCCGCTGATCCAGAAAAACGAAGTAACTAAACTGTTTA GCATCCTGACTAACGGTCCGACTCCGATCCTGTGGGACATCCTGCTGATTTTCTTCCTGTGTTGG TCTATTGGCGTGTGTCTGCACACGTACGAAACCCTGCGCTCTAAACATTACAACATCGCCTTTGA ACTGATCGGTCTGATTTTCCTGGCGTGGTATGCGCCGCCTCTGGTTACGTTTGCCACTTACTTCTG CTTCATTCATTCCCGTCGCCACTTCTCCTTTGTGTGGAAGCAGCTGCAACACATGTCTTCCAAAAA GATGATGATTGGCAGCGCGATTATCCTGTCCTGTACCTCTTGGCTGATCGGCGGTGGTATCTATTT CTTCCTGAACTCCAAAATGATCGCCTCTGAGGCTGCGCTGCAAACTGTGTTCATCGGTCTGGCGGC ACTGACCGTGCCGCACATGATTCTGATCGACTTCATCTTCCGTCCGCACTCTTCCCGTATCAAAATC

AAAAACTGActgcagcggccgctactagta


  • Forward Primer: gtttcttcgaattcgcggccgcttctagaaagaggagaaatactagatgggtctgatg
    • Length= 58 GC= 46.6% Melt= 68.2C


  • Reverse Primer: gtttcttcctgcagcggccgctactagtatcagtttttgattttgatacgggaagagtgcgg
    • Length= 62 GC= 48.4% Melt= 69.9C



Project
Research Proposal
Systems Overview
Cloning Plan
Sequences & Primers
Anti-Inflammation
Device Overview
Parts Design
Challenges
Results
Anti-Immunosuppression
Device Overview
Parts Design
Challenges
Results
Protocols
Modeling
Overview
Notebook
Results
Future Work
Archived Work
Personal tools