User:Tk/Notebook/MF/2008/07/22

From OpenWetWare

Jump to: navigation, search
Mesoplasma florum simplification Main Page
Previous entry      Next entry

Purine riboswitches

  • 29947-30044 unknown lipoprotein (type 1B, 2'dG sensitive)
  • 30987-31083 unknown lipoprotein (type IIB, 2'dG, Guanine, Guanosine sensitive)
  • 31958-32054 glycerol 3 p transport (type IIIA, guanine sensitive)
  • 397027-397123 GMP synthase (type IIIB, guanine sensitive)* 484139-484044 xanthine uracil permease (type IV, adenine sensitive)
  • 625606-626509 ribonucleotide reductase (type 1A, 2'dG sensitive)
  • 668955-668859 phosphate transport (type IIA, 2'dG and G sensitive)
  • 778350-778150 xylose transporter (followed by ribose transport operon and purine nucleoside phosphorylation) (type IIIC, guanine sensitive)

Data from Kim08 paper

Thi Box Sequence

Hit to THI domain at 49321

Alignment of domains THI vs Userseq 163-74/65.32


          .....[[[[[((((,,<<<<<<___________________>>>>>>,,,,<<<<<<<<_
        1 aauaaccaccaGGGGUGCcucuugcaauUuUcAaAaguggaagagGCUGAGaggggggug 60
            +A :::::AG:GGU: C :                     : G :UGAGA+
      163 GUAAGAAGGCAGAGGUAGCGA---------------------AAGCUUGAGAA------- 132


          ______________>>>>>>>>,,)))),,,,,,,,<<<<---<<<<<____>>>>>---
       61 ugaUgcgaguuuucggcuucuagACCCuUuGAugaACCUGAGUCuGGuUAAUaCCaGCGu 120
                               A AC:CUU+GA   ACCUGA UCU:GUUAAUAC:AGCG
      131 ---------------------AUACUCUUAGA---ACCUGA-UCUAGUUAAUACUAGCG- 98


          >>>>,,,,]]]]]............
      121 UAGGGAaAgguggcuauuaauuuua 145
          UAGG+A  ::::: +AU+++UUUU
       97 UAGGAA-GUCCUAAAAUAUUUUUUC 74

>Thi-Box 49483-49384 promoter for Mfl035 unknown transporter (complement)

GUAAGAAGGCAGAGGUAGCGAAAGCUUGAGAAAUACUCUUAGAA
CCUGAUCUAGUUAAUACUAGCGUAGGAAGUCCUAAAAUAUUUUUUC


FMN Riboswitch

  • 670666-670782

SRP RNA fragment

  • 790255-790155

RNAse P RNA fragment

  • 229612-229953

tmRNA

  • 242816-242410

Ribosomal protein L10 leader

  • 706585-706420

Ribosomal protein L21 leader

  • 517214-517135

T-Box

  • approximately 205.7-206.1 (controls ThrS, Mfl177)
  • 450488-450269 (controls IleS, Mfl389)



Personal tools