IGEM:Harvard/2006/DNA nanostructures/Container Design 3

From OpenWetWare

Jump to: navigation, search



Contents

Version 3.0

  • This is a top view with top and bottom (lids) unattached.
  • Each tube is 84 turns (or 27.5 nm) long.
  • The pleated sheets connected to the box by red lines are cross-sectional views of the top and bottom (lids).
    • The red lines represent short single-stranded linker sequences in the scaffold.
    • Notice that the scaffold strand first enters a lid on a positive coil and leaves it on a negative coil (or vice versa).

Dimensions

  • 46 tubes (34.2 nm x 27.0 nm) x 84 bp strands (27.2 nm)
  • each lid strand is connected to the adjacent barrel strand by a short single-strand linker
  • each lid is 15 tubes wide (34.2 nm) x 84 bp (27.2 nm)
  • total scaffold needed = 7116 bp

Version 3.1

Dimensions

  • 42 tubes (36.8 nm x 27.0 nm) x 84 bp strands (27.2 nm)
  • 6132 bp needed

Version 3.2

Design changes

  • lid linker sequences are 18 bp (4 bp previously)
  • scaffold connector strands on lids are 24 bp (12 bp previously)
  • one latch per lid (eight previously)
    • latch connecting lid strands 014/015 to barrel strand 034
    • latch connecting lid strands 033/034 to barrel strand 015
  • 6612 bp needed

Top lid latch design

Linker (24 bp) between lid strand 014 and lid strand 015 (part of scaffold):

5'- GTAAATTCAGAGACTGCGCTTTCC -3'

3' end (21 bp) of scaffold of strand 034:

5'- GATGTTATTACTAATCAAAGA -3'

Scaffold-oligo-oligo-scaffold design:

5'- GGAAAGCGCAGT TTTT TTAGAATCAACCAG ATCGGTATGGCA -3'
5'- TCTTTGATTAG  TTTT CTGGTTGATTCTAA TAGATGTGGCAA -3'

Displacement strands (42 bp and 41 bp, respectively):
5'- TGCCATACCGATCTGGTTGATTCTAAAAAAACTGCGCTTTCC -3' 
5'- TTGCCACATCTATTAGAATCAACCAGAAAACTAATCAAAGA -3'

Scaffold-oligo-staple-oligo-scaffold design:

5'- GGAAAGCGCAGT TTTT TTAGAATCAACCAG -3'
                  5'- TCGTGAAATTCTAA TGGCCCCAATAC -3'
                  5'- CTGGTTGGGATAGA GAGCTGTTCACC -3'
5'- TCTTTGATTAG  TTTT TCTATCCTTCACGA -3'

Displacement strands (26 bp each):
5'- GTATTGGGGCCATTAGAATTTCACGA -3' 
5'- GGTGAACAGCTCTCTATCCCAACCAG -3'


Old core oligo:

36  034 11  034 10  034 09  035 09  035 10  035 11  
    TCTTTGA TTAGTAA TAACATC TCCATCA CGCAAAT TAACCGT 

New core oligo:

36*         034 10  034 09  035 09  035 10  035 11  
                TAA TAACATC TCCATCA CGCAAAT TAACCGT

Bottom lid latch design

Linker (24 bp) between lid strand 035 and lid strand 036 (part of scaffold):

5'- GCCCTGTAGCGGCGCATTAAGCGC -3'

3' end (21 bp) of scaffold of strand 013:

5'- ATCCGCCTGGTACTGAGCAAA -3'

Scaffold-oligo-oligo-scaffold design:

5'- GCGCTTAATGCG  TTTT AGACGTAGTATCAC ATGCTCCACCCG -3'
5'- TGCGAATAGTACCA TTTT GTGATACTACGTCT GAGAAGATGTGC -3'

Displacement strands (42 bp and 44 bp, respectively):
5'- CGGGTGGAGCATGTGATACTACGTCTAAAACGCATTAAGCGC -3' 
5'- GCACATCTTCTCAGACGTAGTATCACAAAATGGTACTATTCGCA -3'

Scaffold-oligo-staple-oligo-scaffold design:

5'- GCGCTTAATGCG   TTTT AGACGTAGTATCAC -3'
                    5'- TCCTGCATACGTCT ATGCTCCACCCG -3'
                    5'- GTGATACTATCTAT GAGAAGATGTGC -3'
5'- TGCGAATAGTACCA TTTT ATAGATATGCAGGA -3'

Displacement strands (26 bp each):
5'- CGGGTGGAGCATAGACGTATGCAGGA -3' 
5'- GCACATCTTCTCATAGATAGTATCAC -3'

Old core oligo (42 bp):

 1  010 01  011 01  011 02  012 02  012 01  013 01  
    ATTATAC CAAAAAA AAGGCTC AAGGAAT TGCGAAT AGTACCA

New core oligo (28 bp):

 1* 010 01  011 01  011 02  012 02  
    ATTATAC CAAAAAA AAGGCTC AAGGAAT

Inward aptamers

Old oligo (42 bp):

 1  013 08  014 08  014 07  015 07  015 08  016 08  
    GGAATAG GGAACCT ATTATTC ACCCTCA GAGCCAC TTTCATC 

New oligo (60 bp):

 1* 013 08  014 08  014 07  015 07  015 08  016 08  
    GGAATAG GGAACCT ATTATTC ACCCTCA GAGCCAC TTTCATC TTT GGTTGGTGTGGTTGG

Old oligo (42 bp):

 2  036 07  035 07  035 08  034 08  034 07  033 07  
    AAGCACT AGTAAAA GAGTCTG ACTTGCC TGAGTAG ACAGAGG 

New oligo (60 bp):

 2* 036 07  035 07  035 08  034 08  034 07  033 07  
    AAGCACT AGTAAAA GAGTCTG ACTTGCC TGAGTAG ACAGAGG TTT GGTTGGTGTGGTTGG

Old oligo (42 bp):

 1  004 03  004 02  004 01  005 01  005 02  005 03  
    AGTCAGA AGCAAAG CGGATTG GTAATAG TAAAATG TTTAGAC 

New oligo (53 bp):

 1* 004 03  004 02  004 01  005 01  005 02    
    AGTCAGA AGCAAAG CGGATTG GTAATAG TAAAATG TTT GGTTGGTGTGGTTGG

Outward apatmers

Old oligo (42 bp):

 1  010 07  011 07  011 08  012 08  012 07  013 07  
    GGCAAAA ATCAGCT TGCTTTC TTTCAAC AGTTTCA ATAGCCC 

New oligo (60 bp):

 1* 010 07  011 07  011 08  012 08  012 07  013 07  
    GGCAAAA ATCAGCT TGCTTTC TTTCAAC AGTTTCA ATAGCCC TTT GGTTGGTGTGGTTGG

Old oligo (42 bp):

 1  031 04  031 05  031 06  032 06  032 05  032 04  
    TCAGATG ATGGCAA TTCATCA CACCTTG CTGAACC TCAAATA 

New oligo (53 bp):

 1* 031 04  031 05  031 06  032 06  032 05    
    TCAGATG ATGGCAA TTCATCA CACCTTG CTGAACC TTT GGTTGGTGTGGTTGG

Old oligo (28 bp):

 1  019 02  020 02  020 01  020 00  
    TTTATCC TCTTTCC AGAGCCT AATTTGC 


New oligo (39 bp):

 1* 019 02  020 02  020 01  
    TTTATCC TCTTTCC AGAGCCT TTT GGTTGGTGTGGTTGG

To do (old)

  • reprogram oligos using my program — done
    • use p8256 — decided not to use, 7308 is sufficient for now, has no insert
  • check my program's output vs. OTP_ra (using Fifer's script) — spot-check is successful. thank you Fifer!
  • spot-check oligos against "flowed" scaffold using InDesign — wrote script instead of using InDesign, but spot-checking successful, and caught bug in program
  • make modifications on latch design — done
  • finalize aptamer locations — done
  • divide oligos into the following categories: — done
    • see pre-working stocks below
  • order oligos!

Matthewmeisel 12:51, 7 July 2006 (EDT)

Pre-working stocks

    • c3.2.1: core barrel oligos
    • c3.2.2: core top lid oligos
    • c3.2.3: core bottom lid oligos
    • c3.2.4: barrel oligos at inside apatamer locations -aptamers
    • c3.2.5: barrel oligos at outside aptamer locations -aptamers
    • c3.2.6: barrel oligos at inside apatamer locations +aptamers
    • c3.2.7: barrel oligos at outside aptamer locations +aptamers
    • c3.2.8: barrel oligos at latch locations -latches
    • c3.2.9: lid oligos at latch locations -latches (empty)
    • c3.2.10: barrel oligos at latch locations +latch1 +latch2
    • c3.2.11: latch oligos from barrel +latch1 -latch2
    • c3.2.12: latch oligos from barrel -latch1 +latch2
    • c3.2.13: lid oligos at latch locations +latch1 +latch2 (empty)
    • c3.2.14: latch oligos from lids +latch1 -latch2
    • c3.2.15: latch oligos from lids -latch1 +latch2
    • c3.2.16: latch staples +latch2
    • c3.2.17: displacement strands: latch1
    • c3.2.18: displacement strands: latch2
Description Contents Total
c3.2.6L: barrel oligos @ inside aptamers + ligand3.2.6.1oa/ob, 3.2.6.2oa/ob, 3.2.6.3o5
c3.2.7L: barrel oligos @ outside aptamers + ligand3.2.7.1oa/ob, 3.2.7.2o, 3.2.7.3o4

(mix 10 μL of each 50 μM stock ligand-oligos to make pre-working stocks)

Working stocks

list in progress

core aptamers latches latch displacement
Stock ID Experiment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
c3.2.A -latches -aptamers xxxxx xx
c3.2.B +latch1 -aptamers xxxxx xx xx
c3.2.C +latch2 -aptamers xxxxx x xx xx
c3.2.D -latches +aptamers_in xxx xx xx
c3.2.E -latches +aptamers_out xxxx xxx
c3.2.F +latch1 +aptamers_in xxx xx xx xx
c3.2.G +latch1 +aptamers_out xxxx x xx xx
c3.2.H +latch2 +aptamers_in xxx xx x xx xx
c3.2.I +latch2 +aptamers_out xxxx x x xx xx
c3.2.J displace latch1 x
c3.2.K displace latch2 x
c3.2.L -latches +aptamers_all xxx xxxx


Final concentration of each oligo in working stocks is 250 nM.

working stock description pre-working stocks (according to chart) water total
c3.2.E-latches
+aptamers_out
1 (94 μL), 2 (28 μL), 3 (30 μL), 4 (3 μL), 7 (3 μL), 8 (2 μL), 9 (0 μL)40 μL200 μL
c3.2.Fo.core+latch1
+aptamers_in
1 (94 μL), 2 (28 μL), 3 (30 μL), 5 (3 μL), 6o (5 μL), 10 (2 μL), 11 (2 μL), 13 (0 μL)36 μL200 μL
c3.2.Fo.latches+latch1
+aptamers_in
14 (2 μL)10.5 μL12.5 μL of 4 μM
c3.2.Go.core+latch1
+aptamers_out
1 (94 μL), 2 (28 μL), 3 (30 μL), 4 (3 μL), 7o (4 μL), 10 (2 μL), 11 (2 μL), 13 (0 μL)37 μL200 μL
c3.2.Go.latches+latch1
+aptamers_out
14 (2 μL)10.5 μL12.5 μL of 4 μM
c3.2.Ho.core+latch2
+aptamers_in
1 (94 μL), 2 (28 μL), 3 (30 μL), 5 (3 μL), 6o (5 μL), 10 (2 μL), 12 (2 μL), 13 (0 μL), 15 (2 μL)34 μL200 μL
c3.2.Ho.latches+latch2
+aptamers_in
16 (4 μL)21 μL25 μL of 2 μM
c3.2.Io.core+latch2
+aptamers_out
1 (94 μL), 2 (28 μL), 3 (30 μL), 4 (3 μL), 7o (4 μL), 10 (2 μL), 12 (2 μL), 13 (0 μL), 15 (2 μL)35 μL200 μL
c3.2.Io.latches+latch2
+aptamers_out
16 (4 μL)21 μL25 μL of 2 μM
c3.2.Fo.all+latch1
+aptamers_in
1 (94 μL), 2 (28 μL), 3 (30 μL), 5 (3 μL), 6o (5 μL), 10 (2 μL), 11 (2 μL), 13 (0 μL), 14 (2 μL), oligo-ligand (1.5 μL 100 μM)32.5 μL200 μL
c3.2.Go.all+latch1
+aptamers_out
1 (94 μL), 2 (28 μL), 3 (30 μL), 4 (3 μL), 7o (4 μL), 10 (2 μL), 11 (2 μL), 13 (0 μL), 14 (2 μL), oligo-ligand (1.5 μL 100 μM)33.5 μL200 μL
c3.2.Ho.all+latch2
+aptamers_in
1 (94 μL), 2 (28 μL), 3 (30 μL), 5 (3 μL), 6o (5 μL), 10 (2 μL), 12 (2 μL), 13 (0 μL), 15 (2 μL), 16 (4 μL), oligo-ligand (1.5 μL 100 μM)28.5 μL200 μL
c3.2.Io.all+latch2
+aptamers_out
1 (94 μL), 2 (28 μL), 3 (30 μL), 4 (3 μL), 7o (4 μL), 10 (2 μL), 12 (2 μL), 13 (0 μL), 15 (2 μL), 16 (4 μL), oligo-ligand (1.5 μL 100 μM)29.5 μL200 μL

Oligo list

link


EM images

Oligo "ligand" aptamers

on the July 31 notebook page

Design figures

Notes about designs

  • Calculating coil length: The distance between stacked base pairs is approximately (3.4 nm / turn) / (10.5 bp / turn) = 0.324 nm / bp.
  • Calculating sheet length: The length of a "sheet" can be calculated using simple trigonometry, as demonstrated by the diagram below.
  • The effective diameter of a coil is 3 nm according to Dr. Shih, but I'm not 100% sure that this figure is correct, so I will call it d until we can verify it.
Personal tools