IGEM:Harvard/2006/Container Design 4/Oligos

From OpenWetWare

Jump to: navigation, search





Contents

(Pre)Working Stocks

Table of c4.0 Working Stocks

8/8 Table of c4.0 Working Stocks

Final Oligo Sequences

Notes:

  • Displacement Strands and Zipper Strands are not included
  • The 'I' and 'O' flags must be removed from oligos with aptamers since it's primarily a sort check and clearly is not part of the sequence.

Barrel Oligos - Sorted
Lid 1 Oligos - Sorted
Lid 2 Oligos - Sorted

Attachment Oligos (Ordered 8.2)

c4.0.4o (outward attachment-oligos) '
c4.0.4.1oaAAGTTTTGCCTGTAGCATTCCCCGTACT
c4.0.4.1obCAGGAGGGAGAGGG TTTTTTTT CCGCGGGCGCGCCCC
c4.0.4.2oaCGGAAATAATTCATATGGTTTTGATTAA
c4.0.4.2obGACTCCTGCCGAAC TTTTTTTT CCGCGGGCGCGCCCC
c4.0.4.3oaTATGGGATGTACCGTAACACTCCCTCAG
c4.0.4.3obAACCGCCATTAGCG TTTTTTTT CCGCGGGCGCGCCCC
c4.0.4.4oaTGAGCCAAAGACACCACGGAAAAATACA
c4.0.4.4obTACATAAAGCTATC TTTTTTTT CCGCGGGCGCGCCCC
c4.0.6o (inward attachment-oligos)
c4.0.6.1oaAGCATAAAGTGTAAAGCCTGGCAAAAAA
c4.0.6.1obAAGGCTCCGATCTA TTTTTTTT CCGCGGGCGCGCCCC
c4.0.6.2oaTAGGAATCATTACCGCGCCCATCGGCTG
c4.0.6.2obTCTTTCCATGCAGA TTTTTTTT CCGCGGGCGCGCCCC
4.0.6.3oa2GCAAGGCCGGAAACGTCACCACGGCATT
c4.0.6.3ob2TTCGGTCAGCCGCC TTTTTTTT CCGCGGGCGCGCCCC
c4.0.6.4oa2TCCAAGAACGGGTATTAAACCAAGCCGT
c4.0.6.4ob2TTTTATTTGCTATT TTTTTTTT CCGCGGGCGCGCCCC

Final Oligo List

c4.0.1: core barrel oligos
oligo 0c4.0.1.1AGCGTAACAAAAGG
oligo 3c4.0.1.2TTGATATTGAGTAACAGTGCCCGTATAAACAGTTAGCTTTTG
oligo 4c4.0.1.3ATGATACAGGAGTGTACTGGTGAGCCGCCGCCAGCATTGACA
oligo 5c4.0.1.4GGAGGTTGAACCGCCACCCTCAGAGCCACCACCCTTTAGCGT
oligo 6c4.0.1.5CAGACTGTAGCGCGTTTTCATATGAAACCATCGATATATTGA
oligo 8c4.0.1.6AAAGTTAATTGAGCGCTAATATCAGAGAGATAACCTTTACAG
oligo 9c4.0.1.7AGAGAATAACATAAAAACAGGCGTCTTTCCAGAGCCTAATTT
oligo 10c4.0.1.8GCCAGTTGGTTTTGAAGCCTTAAATCAAGATTAGTTTCATCG
oligo 12c4.0.1.9ACGCGCCGAGGCATTTTCGAGCGTTATACAAATTCATGGTTT
oligo 13c4.0.1.10GAAATACATGTAAATGCTGATGCAAATCCAATCGCGCGATAG
oligo 14c4.0.1.11CTTAGATTAAGACGCTGAGAAAATCAATATATGTGAGTGAAT
oligo 15c4.0.1.12AACCTTGATTTCAATTACCTGAGCAAAAGAAGATGGAGCTAA
oligo 16c4.0.1.13CTCACATTAATTGCGTTGCGCTAAAGGAATTGCGATTTTCTG
oligo 18c4.0.1.14GGGTTTTTTTCGGAACCTATTATTCTGAAACATGAGCGCAGT
oligo 19c4.0.1.15CTCTGAATTTACCGTTCCAGTGATTGGCCTTGATATTCACAA
oligo 20c4.0.1.16ACAAATAGAGCCACCACCGGAACCGCCTCCCTCAGATAGCCC
oligo 22c4.0.1.17CACCATTACCGACT
oligo 24c4.0.1.18TTACCGATAAGCCCAATAATAAGAGCAA
oligo 25c4.0.1.19GTGAGAATAGAAAGGAACAACTCACTGCCCGCTTTGAGGCGA
oliog 26c4.0.1.20ATTATTCCTTCTGTAAATCGTTCCTTGAAAACATAAAGACAA
oligo 28c4.0.1.21CTGACCTAAATTTATTACCAG
oligo 29c4.0.1.22TATAAAGCCAACGCTCAACAGTTAACAACGCCAACATGTAAT
oligo 30c4.0.1.23TTAGGCATGTTTATCAACAATAGATAAGTCCTGAATTACGAG
oligo 31c4.0.1.24CATGTAGAAACCAATCAATAAATAGCAAGCAAATCCCCGACT
oligo 32c4.0.1.25TGCGGGAACAAAATAAACAGCTGAAAATAGCAGCCCACAAGA
oligo 33c4.0.1.26ATTGAGTAGCCCTTTTTAAGAAAAGTAAGCAGATATATTACG
oligo 34c4.0.1.27CAGTATGTTAGCAAACGTAGATAAGTTTATTTTGTCACAATC
oligo 35c4.0.1.28AATAGAATATTCATTAAAGGTGAATTATCACCGTCACCATTA
oligo 37c4.0.1.29ACCCTCAGAGGCAGGTCAGACAAGCGTCATACATGATGCCCC
oligo 38c4.0.1.30CTGCCTAGCTCAGTACCAGGCGGATAAGTGCCGTCTTTAGTA
oligo 39c4.0.1.31CCGCCACCCTCAGAACCGCCAGAGTTTCGTCACCAGTACAAA
oligo 40c4.0.1.32CTACAACGTCGTCTTTCCAGACGTTAGTAAATGAAATAATAA
oligo 41c4.0.1.33TTTTTTCACGTTGAAAATCTCGGTGCCTAATGAGTATGAAAC
oligo 42c4.0.1.34AAACATCGGAAACAGTACATAGAGTCAATAGTGAAGGTTATA
oligo 44c4.0.1.35ATAAGGCGTTAAATCTAGAAA
oligo 45c4.0.1.36AAGCCTGTTTAGTATCATATGCCAGTAATAAGAGAATATAAA
oligo 46c4.0.1.37GTACCGACGACGACAATAAACAACATGTTCAGCTATTATCAT
oligo 48c4.0.1.38TTGCACCCCAACGCTAACGAGGAAGCGCATTAGACAAAGTCA
oligo 49c4.0.1.39GAGGGTACCAGAAGGAAACCGAGGAAAC
oligo 50c4.0.1.40AGCAAGCCCAATAGGAACCCATTTTGCTAAACAACTTTCAAC
oligo 51c4.0.1.41TGTATCAACAGACA
oligo 52c4.0.1.39CTCCTCAAGAGAAGGATTAGGACCCTCAGAGCCACCACCCTC
oligo 53c4.0.1.42AGTGCCTAAGTATA
oligo 54c4.0.1.43ATGGAAAAAGTATT
oligo 55c4.0.1.44ACCACCAAATAAGT
oligo 56c4.0.1.45GGAACCAAATCCTC
oligo 57c4.0.1.46TTTGCCTCAGAGCC
oligo 58c4.0.1.47AAAATCATTTCATA
oligo 59c4.0.1.48CGATTGAGGGAGGG
oligo 61c4.0.1.49AAACGCATTTGGGA
oligo 62c4.0.1.50GAATACCCAAAAGAACTGGCAACCAGCGCCAAAGACAAAAGG
oligo 63c4.0.1.51TAGCAATAGGTGGC
oligo 64c4.0.1.52CCTGAACGGGAGAA
oligo 65c4.0.1.53TTTTTTGTTTAACGTCAAAAACATATTATTTATCCCAATCCA
oligo 66c4.0.1.54AATCTTACAGCTAC
oligo 67c4.0.1.55GCGAGGCGTTTTAGCGAACCTAGATATAGAAGGCTTATCCGG
oligo 68c4.0.1.56AACAAGCAAGTACC
oligo 69c4.0.1.57TCCTAATCAAGAAA
oligo 70c4.0.1.58GTCCAGACAAAAGG
oligo 71c4.0.1.59GCCATATTAGGGCT
oligo 72c4.0.1.60ATAATTAAAGAATA
oligo 73c4.0.1.61TATTTTAGAGAAAA
oligo 74c4.0.1.62TTTAACCTCCGGCTTAGGTTGTTTATCAAAATCATAGGTCTG
oligo 75c4.0.1.63CTTAGAACGCTATT
oligo 76c4.0.1.64ATTTGAATTACCTTTTTTAATAAGAAAACAAAATTAATTACA
oligo 77c4.0.1.65TCGCGCACCAGTCG
c4.0.2: core top lid oligos
oligo 0c4.0.2.1TAAAGTATAGCATT
oligo 1c4.0.2.2TGGAAGTATGCTGTAGCTCAAAAAGACTTCAAATAAGCAAAG
oligo 3c4.0.2.3GAGAGGCTTACAACAT
oligo 4c4.0.2.4TATTACATTGGGAAGAAAAATACAAAGCTGCTCATTCTTGAC
oligo 5c4.0.2.5AAGAACCGTGTCGAAATCCGCACAAAGTACAACGGCTTTGAG
oligo 6c4.0.2.6GACTAAAGACTTTTTCATGAGGAAGTTTCCATTAAGACCCCC
oligo 7c4.0.2.7AGCGATTATACCAAGCGCGAAGACCTGCTCCATGTTACTTAG
oligo 8c4.0.2.8CCGGAACTAGGCTGGCTGACCTTCATCAAGAGTAATCAGTGA
oligo 9c4.0.2.9ATAAGGCTTGCCCTGACGAGAGAACTGGCTCATTATACCAGT
oligo 10c4.0.2.10CAGGACGGGTAGAAAGATTCATCAGTTGAGATTTACGTTTAC
oligo 11c4.0.2.11CAGACGACGATAAAAACCAAATTTAGACTGGATAGCGTCCAA
oligo 12c4.0.2.12TACTGCGGGTCTTTACCCTGACTATTATAGTCAGATCGCGTT
oligo 13c4.0.2.13TTAATTCGAGCTTCAAAGCGAATGGCTTAGAGCTTAATTGCT
oligo 14c4.0.2.14GAATATATTCATTCCATATAACAGTTGATTCCCAAGGGCGCG
oligo 15c4.0.2.15AGCTGAAAAGGTGGCATCAATTCTACTAATAGTAGCGGTGTC
oligo 16c4.0.2.16ATGGTCAATAACCTGTTTAGCTATATTTTCATTTGTTCTGCG
oligo 17c4.0.2.17AACGAGTGGTCATTTTTGCGGACCAGACCGGAAGCTAAATCA
oligo 18c4.0.2.18AAAATCAGAATCGTCATAAATACTATCATAACCCTGGAATAC
oligo 19c4.0.2.19CACATTCTTATGCGATTTTAAAACACCAGAACGAGACAGACC
oligo 20c4.0.2.20AGGCGCAGAGGCGCAGACGGTAAACACTCATCTTTACGGGTA
oligo 21c4.0.2.21AAATACGTAATGCCACTACGAAGGCACC
oligo 22c4.0.2.22TAATTGCTCCTTTTGATAAGAAGATTTAGTTTGACCATTAGA
olgio 23c4.0.2.23AAGCCCGCATGTTT
oligo 24c4.0.2.24TTCAGAAAACGAGAATGACCAAAACTCCAACAGGTCAGGATT
oligo 25c4.0.2.25AGAGGGGCATCAAA
oligo 26c4.0.2.26ACGAGGCATAGTAAGAGCAACATTCATTGAATCCCCCTCAAA
oligo 27c4.0.2.27TAACGGATTGCAAA
oligo 28c4.0.2.28CTTTAATCATTGTGAATTACCAACTAAT
oligo 30c4.0.2.29CAACGTACTACGTT
oligo 31c4.0.2.30AAGAGGACAGATGAACGGTGTTAGTAAATTGGGCTTGAGATG
oligo 32c4.0.2.31ATAAATTGGATATT
oligo 33c4.0.2.32AAGAGGCAAAAGAATACACTACAATCATAAGGGAACCGAACT
oligo 34c4.0.2.33ACAGAGGAGATTTG
c4.0.3: core bottom lid oligos
oligo 0c4.0.3.1ATACATTGGCAATT
oligo 1c4.0.3.2TTAGAAGTAACAACTAATAGAAGTGCCACGCTGAGAAACAGA
oligo 3c4.0.3.3ACCAGTCAACATCA
oligo 4c4.0.3.4CTTGCCTGCAAATTAACCGTTGAGCACGTATAACGTAATGCG
oligo 5c4.0.3.5CCGCTACCGGAACCCTAAAGGATCAAGTTTTTTGGATCCCTT
oligo 6c4.0.3.6ATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTATGGCCC
oligo 7c4.0.3.7ACTACGTGAACCATCACCCAAGAGCCCCCGATTTAGAGCTTG
oligo 8c4.0.3.8ACGGGGATGCGCGTAACCACCACACCCGCCGCGCTTGCTTTC
oligo 9c4.0.3.9CTCGTTAGAATCAGAGCGGGACCACCGAGTAAAAGAGTCTGT
oligo 10c4.0.3.10CCATCACGAGTAGAAGAACTCAAACTATCGGCCTTATCGTCT
oligo 11c4.0.3.11GAAATGGATTATTTACATTGGTAGAACCCTTCTGACCTGAAA
oligo 12c4.0.3.12GCGTAAGATACCGAACGAACCACCAGCAGAAGATAAGCCAGC
oligo 13c4.0.3.13AGCAAATGAAAAATCTAAAGCAGGTTATCTAAAATATCTTT
oligo 14c4.0.3.14GGAGCACTATTAGACTTTACAAACAATTCGACAACGAAGGAG
oligo 15c4.0.3.15CGGAATTATCATCATATTCCTGATTATCAGATGATTGAGGAT
oligo 16c4.0.3.16TAACATTATCATTTTGCGGAACAAAGAAACCACCATCGTATT
oligo 17c4.0.3.17AAATCCTAAAGGAATTGAGGAATCACCTTGCTGAACATCGCC
oligo 18c4.0.3.18ATTAAAAAATACGTGGCACAGCATTTTGACGCTCAGCTGGTA
oligo 19c4.0.3.19ATATCCATATAATCAGTGAGGGCTAAACAGGAGGCTGTAGCG
oligo 20c4.0.3.20GTCACGCAAGCCGGCGAACGTCGTCTATCAGGGCGGTTGTTC
oligo 21c4.0.3.21CAGTTTGGAACAAGAGTCCACTATTAAA
oligo 22c4.0.3.22CAGTTGGCAAATCAACAGTTGTTGCCCGAACGTTATTAATTT
olgio 23c4.0.3.23CTGCAACTTAGAGC
oligo 24c4.0.3.24CGCGAACTGATAGCCCTAAAACCTCAAATATCAAACCCTCAA
oligo 25c4.0.3.25GGACATTCGGTCAG
oligo 26c4.0.3.26AAACGCTCATGGAAATACCTAACAATATTTTTGAATGGCTAT
oligo 27c4.0.3.27TAGTAATACACGAC
oligo 28c4.0.3.28CAGAATCCTGAGAAGTGTTTTGAACAAT
oligo 30c4.0.3.29CTTTGACGTAGCAA
oligo 31c4.0.3.30GGGCGCTAGGGCGCTGGCAAGCGATTAAAGGGATTTTAGACA
oligo 32c4.0.3.31ACTAAATAGGGCGC
oligo 33c4.0.3.32CAACGTCAAAGGGCGAAAAACGGCGAGAAAGGAAGGGAAGAA
oligo 34c4.0.3.33CGGCAAAGGTCGAG
c4.0.4: barrel oligos @ outside aptamers -aptamers
oligo 2c4.0.4.1AAGTTTTGCCTGTAGCATTCCCCGTACTCAGGAGGGAGAGGG
oligo 7c4.0.4.2CGGAAATAATTCATATGGTTTTGATTAAGACTCCTGCCGAAC
oligo 17c4.0.4.3TATGGGATGTACCGTAACACTCCCTCAGAACCGCCATTAGCG
oligo 23c4.0.4.4TGAGCCAAAGACACCACGGAAAAATACATACATAAAGCTATC
c4.0.5: barrel oligos @ outside aptamers +aptamers
oligo 2c4.0.5.1AAGTTTTGCCTGTAGCATTCCCCGTACTCAGGAGGGAGAGGGTTTGGTTGGTGTGGTTGG
oligo 7c4.0.5.2CGGAAATAATTCATATGGTTTTGATTAAGACTCCTGCCGAACTTTGGTTGGTGTGGTTGG
oligo 17c4.0.5.3TATGGGATGTACCGTAACACTCCCTCAGAACCGCCATTAGCGTTTGGTTGGTGTGGTTGG
oligo 23c4.0.5.4TGAGCCAAAGACACCACGGAAAAATACATACATAAAGCTATCTTTGGTTGGTGTGGTTGG
c4.0.6: barrel oligos @ inside aptamers -aptamers
oligo 1c4.0.6.1AGCATAAAGTGTAAAGCCTGGCAAAAAAAAGGCTCCGATCTA
oligo 11c4.0.6.2TAGGAATCATTACCGCGCCCATCGGCTGTCTTTCCATGCAGA
oligo 36c4.0.6.3GCAAGGCCGGAAACGTCACCACGGCATTTTCGGTCAGCCGCC
oligo 47c4.0.6.4TCCAAGAACGGGTATTAAACCAAGCCGTTTTTATTTGCTATT
c4.0.7: barrel oligos @ inside aptamers +aptamers
oligo 1c4.0.7.1AGCATAAAGTGTAAAGCCTGGCAAAAAAAAGGCTCCGATCTATTTGGTTGGTGTGGTTGG
oligo 11c4.0.7.2TAGGAATCATTACCGCGCCCATCGGCTGTCTTTCCATGCAGATTTGGTTGGTGTGGTTGG
oligo 36c4.0.7.3GCAAGGCCGGAAACGTCACCACGGCATTTTCGGTCAGCCGCCTTTGGTTGGTGTGGTTGG
oligo 47c4.0.7.4TCCAAGAACGGGTATTAAACCAAGCCGTTTTTATTTGCTATTTTTGGTTGGTGTGGTTGG
c4.0.8: two-oligo latch sequences for barrel
oligo 21c4.0.8.1CCTTATTAGCGTTTGCCATCTCCAGTAGTTTTTTTTTTTCGAGTTGACAAAGCTACCGGTTCAAG
oligo 27c4.0.8.2AGAACGCGTTAATTTCATCTTTTTTTTTTTTTTTTCAGGATACCATCATCTACTAACCGGTG
oligo 43c4.0.8.3TAACTATCGACCGTGTGATAATTTTTTTTTTTTTGTACGCATGGCAAATTACCACTCTAGC
oligo 60c4.0.8.4AAGGTAAAGCAGCACCGTAATTTTTTTTGTAACGAAGTTGCACCACACAACGCTA
c4.0.9: four-oligo latch sequences for barrel
oligo 21c4.0.9.1CCTTATTAGCGTTTGCCATCTCCAGTAGTTTTTTTTTTGGCACTCCTACAATT
oligo 27c4.0.9.2AGAACGCGTTAATTTCATCTTTTTTTTTTTTTTTTGACGATAGGGAAACA
oligo 43c4.0.9.3TAACTATCGACCGTGTGATAATTTTTTTTTTTTTTGGATCGGTACATTGT
oligo 60c4.0.9.4AAGGTAAAGCAGCACCGTAATTTTTTTTCCGGTGCAGAAGTTT
c4.0.10: barrel oligos @ latches -latches
oligo 21c4.0.10.1CCTTATTAGCGTTTGCCATCTCCAGTAG
oligo 27c4.0.10.2AGAACGCGTTAATTTCATCTT
oligo 43c4.0.10.3TAACTATCGACCGTGTGATAA
oligo 60c4.0.10.4AAGGTAAAGCAGCACCGTAAT
c4.0.11: two-oligo latch sequences for top lid
oligo 2c4.0.11.1CGGATTGGTAATAGTAAAATGATAGCGATTTTTTTGTGCAACTTCGTTACACGAGTAATGCG
oligo 29c4.0.11.2GCAGATACATAACGTTTTTTTTTTTTTTATTTGCCATGCGTACCGGTTAGATAGC
c4.0.12: two-oligo latch sequences for bottom lid
oligo 2c4.0.12.1GGTGAGGCTGGCCAACAGAGACAGATTCTTTTTTTTTTTGCTTTGTCAACTCGAACTGGCCCTTAA
oligo 29c4.0.12.2ATTACCGCCAGCCATTTTTTTTTTTTTTGATGATGGTATCCTGGTGGAGTAGTTG
c4.0.13: four-oligo latch sequences for top lid
oligo 2c4.0.13.1CGGATTGGTAATAGTAAAATGATAGCGATTTTTTTTAGAGACGACCATAC
oligo 29c4.0.13.2GCAGATACATAACGTTTTTTTTTTTTTTAGGCAACTCGAATAC
c4.0.14: four-oligo latch seequences for bottom lid
oligo 2c4.0.14.1GGTGAGGCTGGCCAACAGAGACAGATTCTTTTTTTTTTTGTAGTAGAGACCAAC
oligo 29c4.0.14.2ATTACCGCCAGCCATTTTTTTTTTTTTTCCTACGAGAAGATCA
c4.0.15: top lid oligos @ latches -latches
oligo 2c4.0.15.1CGGATTGGTAATAGTAAAATGATAGCGA
oligo 29c4.0.15.2GCAGATACATAACG
c4.0.16: bottom lid oligos @ latches -latches
oligo 2c4.0.16.1GGTGAGGCTGGCCAACAGAGACAGATTC
oligo 29c4.0.16.2ATTACCGCCAGCCA
c4.0.17: two-oligo latch barrel displacement oligos
for oligo 21c4.0.17.1CTTGAACCGGTAGCTTTGTCAACTCGA
for oligo 27c4.0.17.2CACCGGTTAGTAGATGATGGTATCCTG
for oligo 43c4.0.17.3GCTAGAGTGGTAATTTGCCATGCGTAC
for oligo 60c4.0.17.4TAGCGTTGTGTGGTGCAACTTCGTTAC
c4.0.18: two-oligo latch top lid displacement oligos
for oligo 2c4.0.18.1CGCATTACTCGTGTAACGAAGTTGCAC
for oligo 29c4.0.18.2GCTATCTAACCGGTACGCATGGCAAAT
c4.0.19: two-oligo latch bottom lid displacement oligos
for oligo 2c4.0.19.1TTAAGGGCCAGTTCGAGTTGACAAAGC
for oligo 29c4.0.19.2CAACTACTCCACCAGGATACCATCATC
c4.0.20: four-oligo latch barrel displacement oligos
for oligo 21c4.0.20.1TTATTGCCGTGCGGCACTCAGACCAAC
for oligo 27c4.0.20.2ATCGCTCACAACGACGATAGAAGATCA
for oligo 43c4.0.20.3CCTAGAAAGTCCGGATCGGTCGAATAC
for oligo 60c4.0.20.4TAGCGGTACTCACCGGTGCGACCATAC
c4.0.21: four-oligo latch top lid displacement oligos
for oligo 2c4.0.21.1CGACTGAAGAGATAGAGACAGAAGTTT
for oligo 29c4.0.21.2GTACCCTTAACCAGGCAACTACATTGT
c4.0.22: four-oligo latch bottom lid displacement oligos
for oligo 2c4.0.22.1GAATAGCCTTCGGTAGTAGCTACAATT
for oligo 29c4.0.22.2CACAAGCACTGACCTACGAGGGAAACA
c4.0.23: barrel zipper oligos
for oligo 21c4.0.23.1GTTGGTCTGAGTGCCGCACGGCAATAA
for oligo 27c4.0.23.2TGATCTTCTATCGTCGTTGTGAGCGAT
for oligo 43c4.0.23.3GTATTCGACCGATCCGGACTTTCTAGG
for oligo 60c4.0.23.4GTATGGTCGCACCGGTGAGTACCGCTA
c4.0.24: top lid zipper oligos
for oligo 2c4.0.24.1AAACTTCTGTCTCTATCTCTTCAGTCG
for oligo 29c4.0.24.2ACAATGTAGTTGCCTGGTTAAGGGTAC
c4.0.25: bottom lid zipper oligos
for oligo 2c4.0.25.1AATTGTAGCTACTACCGAAGGCTATTC
for oligo 29c4.0.25.2TGTTTCCCTCGTAGGTCAGTGCTTGTG
Personal tools